Incidental Mutation 'R0884:Abcc4'
ID81098
Institutional Source Beutler Lab
Gene Symbol Abcc4
Ensembl Gene ENSMUSG00000032849
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 4
SynonymsMRP4, D630049P08Rik, MOAT-B
MMRRC Submission 039051-MU
Accession Numbers

Genbank: NM_001033336.3, NM_001163675.1, NM_001163676.1; Ensembl: ENSMUST00000036554

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0884 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location118482692-118706219 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 118553288 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 844 (I844N)
Ref Sequence ENSEMBL: ENSMUSP00000042186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036554] [ENSMUST00000166646]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036554
AA Change: I844N

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000042186
Gene: ENSMUSG00000032849
AA Change: I844N

DomainStartEndE-ValueType
Pfam:ABC_membrane 92 365 4.5e-37 PFAM
AAA 437 610 5.71e-12 SMART
Pfam:ABC_membrane 714 993 4.2e-47 PFAM
AAA 1067 1251 2.02e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000166646
AA Change: I769N

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000129677
Gene: ENSMUSG00000032849
AA Change: I769N

DomainStartEndE-ValueType
Pfam:ABC_membrane 98 290 4.1e-22 PFAM
AAA 362 535 5.71e-12 SMART
Pfam:ABC_membrane 638 922 4.6e-39 PFAM
AAA 992 1176 2.02e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226703
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228848
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This family member plays a role in cellular detoxification as a pump for its substrate, organic anions. It may also function in prostaglandin-mediated cAMP signaling in ciliogenesis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous null mice are viable and fertile. Homozygotes for one null allele display impaired organic anion transport in the blood-brain and blood-cerebrospinal fluid barriers and kidney. Homozygotes for a second null allele display hypoalgesia and abnormal PGE2 physiology. [provided by MGI curators]
Allele List at MGI

All alleles(143) : Targeted, knock-out(2) Gene trapped(141)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd3 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA 1: 180,747,059 probably benign Het
Adam6b A T 12: 113,490,995 R477S probably damaging Het
Aqp7 T A 4: 41,034,929 T175S possibly damaging Het
Bclaf1 A T 10: 20,322,076 R22* probably null Het
Bend7 A T 2: 4,744,244 K57N probably damaging Het
Bicc1 A C 10: 70,958,847 V160G probably damaging Het
Cacna2d4 C T 6: 119,307,286 R745W probably damaging Het
Cep72 A G 13: 74,054,881 probably null Het
Cobl A G 11: 12,375,908 I196T possibly damaging Het
Cux1 T G 5: 136,307,835 D941A probably damaging Het
Cyp2a12 T C 7: 27,032,542 I236T probably benign Het
Depdc5 T A 5: 32,917,978 V500D possibly damaging Het
Dhx35 T C 2: 158,831,711 I354T probably damaging Het
Dnase1l2 A G 17: 24,441,880 V170A possibly damaging Het
Eif4g3 C A 4: 138,151,776 N588K possibly damaging Het
Epsti1 A T 14: 77,931,275 R117S probably damaging Het
Fam53a T C 5: 33,600,816 E321G probably benign Het
Fat4 C A 3: 38,982,858 T3553K possibly damaging Het
Fer1l4 T C 2: 156,019,313 T1978A possibly damaging Het
Gabarapl2 A T 8: 111,942,505 I32F probably damaging Het
Gje1 G T 10: 14,716,740 S99R possibly damaging Het
Gm13083 A G 4: 143,615,184 D61G probably benign Het
Gosr1 A G 11: 76,730,146 I239T probably benign Het
Gpnmb T C 6: 49,047,913 V293A possibly damaging Het
Hyi T A 4: 118,360,217 I62N probably damaging Het
Il4ra A G 7: 125,574,663 I267V probably damaging Het
Kcnd2 A T 6: 21,216,541 Q81H probably benign Het
Ksr1 A T 11: 79,021,503 H675Q possibly damaging Het
Lpcat4 A G 2: 112,242,732 N208S probably damaging Het
Muc3 T A 5: 137,142,298 T162S possibly damaging Het
Mup3 T A 4: 62,087,174 I20F possibly damaging Het
Nebl A C 2: 17,411,118 S327A probably benign Het
Nfatc4 A C 14: 55,826,644 D126A probably damaging Het
Nmt2 A T 2: 3,314,785 R271* probably null Het
Nol7 G A 13: 43,400,615 V133I probably benign Het
Olfr376 A T 11: 73,374,889 I47F probably benign Het
Olfr610 C T 7: 103,506,862 W28* probably null Het
Pde4d A T 13: 109,950,940 I670L probably damaging Het
Phlpp1 T A 1: 106,389,665 probably null Het
Pigz A G 16: 31,941,976 probably null Het
Prrg4 A T 2: 104,839,362 Y137N probably damaging Het
Rbm28 A T 6: 29,155,154 S217T possibly damaging Het
Ryr2 T C 13: 11,554,529 D4963G probably damaging Het
Slc35b2 T A 17: 45,566,825 F293I probably damaging Het
Slc35f1 A T 10: 53,089,347 Y286F probably damaging Het
Slc6a18 G T 13: 73,667,037 A384D probably damaging Het
St5 A G 7: 109,557,345 L66P probably damaging Het
Syt9 A G 7: 107,436,561 I262V probably damaging Het
Tln2 C A 9: 67,370,733 R333L probably damaging Het
Tnrc6b ACAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAG 15: 80,902,555 probably benign Het
Ttn G A 2: 76,751,066 T14834I possibly damaging Het
Uggt1 T C 1: 36,175,078 S177G probably benign Het
Zfp454 A G 11: 50,873,937 S223P probably benign Het
Zmat4 A G 8: 24,015,127 T128A probably benign Het
Other mutations in Abcc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00768:Abcc4 APN 14 118528997 missense probably benign 0.03
IGL01152:Abcc4 APN 14 118599385 missense probably damaging 1.00
IGL01511:Abcc4 APN 14 118599341 missense probably benign 0.03
IGL01604:Abcc4 APN 14 118527994 missense possibly damaging 0.94
IGL01725:Abcc4 APN 14 118500829 missense probably damaging 1.00
IGL01828:Abcc4 APN 14 118553279 splice site probably benign
IGL02174:Abcc4 APN 14 118500742 missense probably damaging 0.98
IGL02391:Abcc4 APN 14 118553352 missense probably damaging 1.00
IGL02500:Abcc4 APN 14 118618926 missense possibly damaging 0.47
IGL02598:Abcc4 APN 14 118668369 nonsense probably null
IGL02668:Abcc4 APN 14 118611475 missense probably damaging 1.00
IGL02708:Abcc4 APN 14 118500801 missense probably damaging 1.00
IGL02859:Abcc4 APN 14 118516500 missense probably damaging 1.00
IGL03249:Abcc4 APN 14 118627706 splice site probably benign
IGL03257:Abcc4 APN 14 118615211 missense probably benign 0.01
IGL03298:Abcc4 APN 14 118611468 missense probably damaging 1.00
1mM(1):Abcc4 UTSW 14 118629656 nonsense probably null
R0743:Abcc4 UTSW 14 118553288 missense possibly damaging 0.90
R1139:Abcc4 UTSW 14 118500840 missense possibly damaging 0.56
R1238:Abcc4 UTSW 14 118597639 splice site probably benign
R1588:Abcc4 UTSW 14 118534072 missense probably benign 0.01
R1678:Abcc4 UTSW 14 118594894 missense probably benign 0.08
R1785:Abcc4 UTSW 14 118553349 missense probably damaging 0.99
R1786:Abcc4 UTSW 14 118553349 missense probably damaging 0.99
R1961:Abcc4 UTSW 14 118611456 missense probably damaging 0.98
R1961:Abcc4 UTSW 14 118611459 missense possibly damaging 0.92
R1993:Abcc4 UTSW 14 118526282 missense probably benign 0.02
R2025:Abcc4 UTSW 14 118553325 missense probably benign 0.13
R3613:Abcc4 UTSW 14 118627451 critical splice donor site probably null
R3864:Abcc4 UTSW 14 118616415 missense probably benign
R4274:Abcc4 UTSW 14 118629622 missense probably damaging 1.00
R4459:Abcc4 UTSW 14 118599393 missense probably benign 0.11
R4601:Abcc4 UTSW 14 118632163 missense probably benign 0.00
R4665:Abcc4 UTSW 14 118529002 missense probably benign
R4678:Abcc4 UTSW 14 118627691 missense probably damaging 0.97
R4771:Abcc4 UTSW 14 118484384 missense probably benign 0.00
R4962:Abcc4 UTSW 14 118668399 missense probably benign 0.33
R4997:Abcc4 UTSW 14 118516503 nonsense probably null
R5273:Abcc4 UTSW 14 118594821 missense possibly damaging 0.76
R5526:Abcc4 UTSW 14 118631037 missense probably benign 0.10
R5652:Abcc4 UTSW 14 118618927 missense probably benign 0.00
R5820:Abcc4 UTSW 14 118604195 missense probably benign 0.14
R5873:Abcc4 UTSW 14 118526290 missense probably benign 0.00
R6008:Abcc4 UTSW 14 118490566 missense possibly damaging 0.63
R6080:Abcc4 UTSW 14 118669050 missense possibly damaging 0.75
R6222:Abcc4 UTSW 14 118529956 missense probably damaging 1.00
R6919:Abcc4 UTSW 14 118594894 missense probably benign 0.08
R6931:Abcc4 UTSW 14 118527988 missense probably damaging 0.99
R7013:Abcc4 UTSW 14 118526343 missense probably benign
R7055:Abcc4 UTSW 14 118594785 nonsense probably null
R7146:Abcc4 UTSW 14 118615181 missense probably damaging 1.00
R7365:Abcc4 UTSW 14 118627654 missense probably damaging 1.00
R7402:Abcc4 UTSW 14 118706075 missense probably damaging 1.00
R7438:Abcc4 UTSW 14 118616446 missense probably benign 0.01
R7528:Abcc4 UTSW 14 118529905 missense probably damaging 0.99
R7674:Abcc4 UTSW 14 118611487 missense probably damaging 1.00
R7769:Abcc4 UTSW 14 118615270 frame shift probably null
R7823:Abcc4 UTSW 14 118534072 missense probably benign 0.01
R7847:Abcc4 UTSW 14 118627480 missense probably damaging 1.00
R7930:Abcc4 UTSW 14 118627480 missense probably damaging 1.00
R8044:Abcc4 UTSW 14 118615270 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GTAAGTCGAATCCGTGCCAGATACC -3'
(R):5'- TTCTCTGTCCGGCAGCATTCAG -3'

Sequencing Primer
(F):5'- AGCCACTTACCAGCGTGTAG -3'
(R):5'- CCGTTGCCATTGACATGGG -3'
Posted On2013-11-07