Incidental Mutation 'R0975:Myh6'
ID81101
Institutional Source Beutler Lab
Gene Symbol Myh6
Ensembl Gene ENSMUSG00000040752
Gene Namemyosin, heavy polypeptide 6, cardiac muscle, alpha
Synonymsalpha myosin, A830009F23Rik, alpha cardiac MHC, cardiomyopathy, hypertrophic 1, Myhca, Myhc-a, alpha-MHC
MMRRC Submission 039104-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0975 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location54941921-54966927 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54953369 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 950 (S950P)
Ref Sequence ENSEMBL: ENSMUSP00000154634 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081857] [ENSMUST00000226297]
Predicted Effect probably damaging
Transcript: ENSMUST00000081857
AA Change: S950P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000080538
Gene: ENSMUSG00000040752
AA Change: S950P

DomainStartEndE-ValueType
Pfam:Myosin_N 34 73 1.9e-15 PFAM
MYSc 79 781 N/A SMART
IQ 782 804 1.15e-1 SMART
IQ 808 830 3.32e2 SMART
Pfam:Myosin_tail_1 845 1926 2.1e-162 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083498
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131892
Predicted Effect probably damaging
Transcript: ENSMUST00000226297
AA Change: S950P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Meta Mutation Damage Score 0.1452 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cardiac muscle myosin is a hexamer consisting of two heavy chain subunits, two light chain subunits, and two regulatory subunits. This gene encodes the alpha heavy chain subunit of cardiac myosin. The gene is located approximately 4kb downstream of the gene encoding the beta heavy chain subunit of cardiac myosin. Mutations in this gene cause familial hypertrophic cardiomyopathy and atrial septal defect 3. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality associated with heart defects while heterozygotes show cardiac myofibrillar disarray, cardiac dysfunction and fibrosis. Mice heterozygous for different knock-in alleles may develop hypertrophic or dilated forms of cardiomyopathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ampd2 T C 3: 108,077,121 Y464C probably damaging Het
Arap2 A T 5: 62,730,886 probably benign Het
Arhgap5 T G 12: 52,517,144 N299K possibly damaging Het
Atl3 G A 19: 7,521,135 W210* probably null Het
Bag1 T C 4: 40,937,152 N320D probably benign Het
C530008M17Rik T C 5: 76,856,318 probably benign Het
Ccdc39 T C 3: 33,844,125 N24D probably damaging Het
Ccdc88b G A 19: 6,846,625 P1420L probably damaging Het
Cdr2 G A 7: 120,958,391 P304S probably benign Het
Col20a1 A T 2: 181,006,826 I969F possibly damaging Het
Coro1c C G 5: 113,882,121 R11P probably damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Cyp2c67 T G 19: 39,609,178 K459Q possibly damaging Het
Cyp2c68 T C 19: 39,703,358 T374A possibly damaging Het
Efcab6 T A 15: 83,973,331 N289I probably benign Het
Elmo1 T A 13: 20,251,137 I126N probably damaging Het
Esr2 C T 12: 76,145,308 M315I possibly damaging Het
Fbxw14 T A 9: 109,271,239 N449I probably benign Het
Frmpd1 C T 4: 45,279,000 T575I probably benign Het
Gm14403 T G 2: 177,509,424 N145K probably damaging Het
Gm5346 A G 8: 43,625,118 F690L probably benign Het
Gnl2 A G 4: 125,048,378 D392G probably damaging Het
Hmcn1 A C 1: 150,577,377 S5396A probably benign Het
Hoxd12 G T 2: 74,675,934 R230L probably damaging Het
Khsrp T A 17: 57,027,066 D154V possibly damaging Het
Klhl28 C T 12: 64,951,688 R344H possibly damaging Het
Klhl3 C T 13: 58,013,863 V473M possibly damaging Het
Larp1b A G 3: 40,970,490 E134G probably damaging Het
Mcm9 G A 10: 53,538,646 Q113* probably null Het
Mug1 A T 6: 121,878,539 D944V probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Olfr177 T A 16: 58,873,150 probably null Het
Olfr353 C A 2: 36,890,550 M99I possibly damaging Het
Plcb4 T C 2: 135,987,912 probably benign Het
Pomt1 T A 2: 32,253,895 probably null Het
Ppil2 T A 16: 17,107,213 T32S probably benign Het
Prpf8 T C 11: 75,508,674 probably benign Het
Rad9b C T 5: 122,334,257 probably null Het
Recql5 A C 11: 115,923,256 D240E probably damaging Het
Sec31a A C 5: 100,395,904 probably null Het
Slc5a4b A G 10: 76,081,407 V265A probably benign Het
Snx29 A T 16: 11,347,871 D7V possibly damaging Het
Stk31 C G 6: 49,423,409 D389E probably damaging Het
Tmeff2 T C 1: 50,938,205 probably benign Het
Tmem131 C T 1: 36,854,885 A146T probably damaging Het
Tmem63c T A 12: 87,075,069 probably benign Het
Tonsl T A 15: 76,638,932 D119V probably damaging Het
Trmt10a G A 3: 138,156,809 E287K probably benign Het
Vmn1r192 T A 13: 22,187,463 M196L probably damaging Het
Vmn2r9 T G 5: 108,843,303 T731P probably damaging Het
Wfdc6b G A 2: 164,613,785 M11I probably damaging Het
Zfp827 A G 8: 79,061,185 T327A probably benign Het
Other mutations in Myh6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Myh6 APN 14 54946993 missense probably benign 0.13
IGL00401:Myh6 APN 14 54953417 missense probably benign 0.00
IGL01062:Myh6 APN 14 54952292 missense probably damaging 0.99
IGL01300:Myh6 APN 14 54963091 missense possibly damaging 0.94
IGL01688:Myh6 APN 14 54963960 missense possibly damaging 0.74
IGL01695:Myh6 APN 14 54957413 missense probably benign 0.01
IGL01762:Myh6 APN 14 54962081 missense probably benign 0.17
IGL01803:Myh6 APN 14 54944543 missense probably damaging 1.00
IGL02079:Myh6 APN 14 54950541 missense probably damaging 1.00
IGL02315:Myh6 APN 14 54953834 missense probably damaging 1.00
IGL02340:Myh6 APN 14 54957155 missense possibly damaging 0.76
IGL02377:Myh6 APN 14 54944318 missense probably benign 0.10
IGL02715:Myh6 APN 14 54946908 unclassified probably benign
IGL02742:Myh6 APN 14 54953924 missense possibly damaging 0.62
P0028:Myh6 UTSW 14 54963637 missense probably benign
PIT4520001:Myh6 UTSW 14 54950124 missense probably benign 0.00
R0058:Myh6 UTSW 14 54963404 missense probably damaging 1.00
R0090:Myh6 UTSW 14 54958704 missense probably damaging 0.97
R0360:Myh6 UTSW 14 54948347 nonsense probably null
R0364:Myh6 UTSW 14 54948347 nonsense probably null
R0395:Myh6 UTSW 14 54946320 missense possibly damaging 0.94
R0549:Myh6 UTSW 14 54958608 missense probably damaging 1.00
R0559:Myh6 UTSW 14 54958554 missense probably benign
R0800:Myh6 UTSW 14 54953278 splice site probably benign
R0892:Myh6 UTSW 14 54947054 missense probably benign 0.17
R1051:Myh6 UTSW 14 54949527 missense probably benign 0.12
R1180:Myh6 UTSW 14 54944468 missense possibly damaging 0.93
R1311:Myh6 UTSW 14 54946365 missense probably damaging 0.96
R1490:Myh6 UTSW 14 54962718 nonsense probably null
R1531:Myh6 UTSW 14 54956506 missense probably damaging 1.00
R1835:Myh6 UTSW 14 54957401 missense probably benign 0.03
R1845:Myh6 UTSW 14 54944674 missense probably damaging 1.00
R2033:Myh6 UTSW 14 54963645 missense probably benign 0.00
R2143:Myh6 UTSW 14 54952954 missense probably damaging 1.00
R2146:Myh6 UTSW 14 54953771 missense probably damaging 1.00
R2155:Myh6 UTSW 14 54953794 missense probably benign
R2484:Myh6 UTSW 14 54961242 nonsense probably null
R3155:Myh6 UTSW 14 54944668 missense probably damaging 0.97
R3156:Myh6 UTSW 14 54944668 missense probably damaging 0.97
R3780:Myh6 UTSW 14 54963958 missense probably benign 0.00
R3906:Myh6 UTSW 14 54956955 missense probably benign 0.04
R3937:Myh6 UTSW 14 54963055 missense probably benign 0.00
R3938:Myh6 UTSW 14 54963055 missense probably benign 0.00
R4236:Myh6 UTSW 14 54960362 missense probably benign 0.15
R4373:Myh6 UTSW 14 54962108 missense probably damaging 0.97
R4374:Myh6 UTSW 14 54962108 missense probably damaging 0.97
R4377:Myh6 UTSW 14 54962108 missense probably damaging 0.97
R4798:Myh6 UTSW 14 54953293 missense probably damaging 1.00
R4844:Myh6 UTSW 14 54947194 missense possibly damaging 0.89
R4908:Myh6 UTSW 14 54956962 missense probably damaging 1.00
R5256:Myh6 UTSW 14 54952661 missense probably damaging 1.00
R5277:Myh6 UTSW 14 54956562 missense probably benign 0.01
R5356:Myh6 UTSW 14 54953762 missense probably damaging 1.00
R5433:Myh6 UTSW 14 54953924 missense probably benign 0.32
R5616:Myh6 UTSW 14 54956581 missense probably benign 0.17
R5784:Myh6 UTSW 14 54953064 missense possibly damaging 0.93
R5820:Myh6 UTSW 14 54958680 missense probably damaging 0.99
R5835:Myh6 UTSW 14 54950407 missense probably damaging 1.00
R5922:Myh6 UTSW 14 54946474 missense probably damaging 0.99
R5975:Myh6 UTSW 14 54950508 missense probably benign 0.31
R5988:Myh6 UTSW 14 54965394 missense probably damaging 1.00
R6630:Myh6 UTSW 14 54942001 missense probably benign 0.01
R6845:Myh6 UTSW 14 54944749 missense probably benign
R7009:Myh6 UTSW 14 54952292 missense probably damaging 0.99
R7154:Myh6 UTSW 14 54960307 missense probably benign 0.43
R7293:Myh6 UTSW 14 54947174 missense probably benign 0.00
R7313:Myh6 UTSW 14 54960270 missense probably benign 0.00
R7339:Myh6 UTSW 14 54961568 intron probably null
R7348:Myh6 UTSW 14 54952259 missense probably damaging 1.00
R7487:Myh6 UTSW 14 54953496 nonsense probably null
R7680:Myh6 UTSW 14 54948733 missense possibly damaging 0.88
R7726:Myh6 UTSW 14 54965365 missense probably damaging 0.99
Z1088:Myh6 UTSW 14 54956997 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAATGATTTCATCCAGCCCAGCC -3'
(R):5'- ACAACCTCAATGATGCAGAGGAGC -3'

Sequencing Primer
(F):5'- ataaataaatCCACCTTGCCTTTAGG -3'
(R):5'- CTGTGACCAGCTGATCAAGAACA -3'
Posted On2013-11-07