Incidental Mutation 'R0884:Dnase1l2'
ID81102
Institutional Source Beutler Lab
Gene Symbol Dnase1l2
Ensembl Gene ENSMUSG00000024136
Gene Namedeoxyribonuclease 1-like 2
Synonyms4733401H14Rik
MMRRC Submission 039051-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0884 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location24440081-24443105 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24441880 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 170 (V170A)
Ref Sequence ENSEMBL: ENSMUSP00000113508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024946] [ENSMUST00000056032] [ENSMUST00000088506] [ENSMUST00000119932] [ENSMUST00000148820] [ENSMUST00000154675] [ENSMUST00000226654] [ENSMUST00000226754] [ENSMUST00000226941]
Predicted Effect probably benign
Transcript: ENSMUST00000024946
SMART Domains Protein: ENSMUSP00000024946
Gene: ENSMUSG00000024132

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
Pfam:ECH_1 39 288 3.2e-96 PFAM
Pfam:ECH_2 44 289 5.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056032
SMART Domains Protein: ENSMUSP00000062344
Gene: ENSMUSG00000024137

DomainStartEndE-ValueType
low complexity region 6 35 N/A INTRINSIC
ZnF_C2H2 57 82 3.95e1 SMART
low complexity region 84 99 N/A INTRINSIC
ZnF_C2H2 193 215 1.03e-2 SMART
ZnF_C2H2 221 243 7.37e-4 SMART
ZnF_C2H2 249 269 5.62e0 SMART
low complexity region 295 311 N/A INTRINSIC
ZnF_C2H2 433 455 5.9e-3 SMART
ZnF_C2H2 461 483 2.4e-3 SMART
ZnF_C2H2 489 511 2.49e-1 SMART
ZnF_C2H2 517 539 1.82e-3 SMART
ZnF_C2H2 545 567 1.56e-2 SMART
ZnF_C2H2 573 593 2.06e1 SMART
low complexity region 599 611 N/A INTRINSIC
low complexity region 642 661 N/A INTRINSIC
low complexity region 703 713 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000088506
AA Change: V170A

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000085862
Gene: ENSMUSG00000024136
AA Change: V170A

DomainStartEndE-ValueType
DNaseIc 5 276 4.18e-185 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000119932
AA Change: V170A

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113508
Gene: ENSMUSG00000024136
AA Change: V170A

DomainStartEndE-ValueType
DNaseIc 5 276 4.18e-185 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129401
Predicted Effect probably benign
Transcript: ENSMUST00000148820
SMART Domains Protein: ENSMUSP00000119453
Gene: ENSMUSG00000024136

DomainStartEndE-ValueType
Blast:DNaseIc 5 60 2e-33 BLAST
PDB:4AWN|A 22 60 5e-8 PDB
SCOP:d2dnja_ 22 60 3e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153858
Predicted Effect possibly damaging
Transcript: ENSMUST00000154675
AA Change: V98A

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116743
Gene: ENSMUSG00000024136
AA Change: V98A

DomainStartEndE-ValueType
DNaseIc 1 180 4.58e-86 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226654
Predicted Effect probably benign
Transcript: ENSMUST00000226754
Predicted Effect probably benign
Transcript: ENSMUST00000226941
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227241
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227293
Predicted Effect probably benign
Transcript: ENSMUST00000228882
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruption in this gene retain DNA in corneocytes of the hair and some other structures. Mice homozygous for a different knock-out allele exhibit decreased grip strength, decreased body weight, abnormal homeostasis and abnormal skeleton. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 A T 14: 118,553,288 I844N possibly damaging Het
Acbd3 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA 1: 180,747,059 probably benign Het
Adam6b A T 12: 113,490,995 R477S probably damaging Het
Aqp7 T A 4: 41,034,929 T175S possibly damaging Het
Bclaf1 A T 10: 20,322,076 R22* probably null Het
Bend7 A T 2: 4,744,244 K57N probably damaging Het
Bicc1 A C 10: 70,958,847 V160G probably damaging Het
Cacna2d4 C T 6: 119,307,286 R745W probably damaging Het
Cep72 A G 13: 74,054,881 probably null Het
Cobl A G 11: 12,375,908 I196T possibly damaging Het
Cux1 T G 5: 136,307,835 D941A probably damaging Het
Cyp2a12 T C 7: 27,032,542 I236T probably benign Het
Depdc5 T A 5: 32,917,978 V500D possibly damaging Het
Dhx35 T C 2: 158,831,711 I354T probably damaging Het
Eif4g3 C A 4: 138,151,776 N588K possibly damaging Het
Epsti1 A T 14: 77,931,275 R117S probably damaging Het
Fam53a T C 5: 33,600,816 E321G probably benign Het
Fat4 C A 3: 38,982,858 T3553K possibly damaging Het
Fer1l4 T C 2: 156,019,313 T1978A possibly damaging Het
Gabarapl2 A T 8: 111,942,505 I32F probably damaging Het
Gje1 G T 10: 14,716,740 S99R possibly damaging Het
Gm13083 A G 4: 143,615,184 D61G probably benign Het
Gosr1 A G 11: 76,730,146 I239T probably benign Het
Gpnmb T C 6: 49,047,913 V293A possibly damaging Het
Hyi T A 4: 118,360,217 I62N probably damaging Het
Il4ra A G 7: 125,574,663 I267V probably damaging Het
Kcnd2 A T 6: 21,216,541 Q81H probably benign Het
Ksr1 A T 11: 79,021,503 H675Q possibly damaging Het
Lpcat4 A G 2: 112,242,732 N208S probably damaging Het
Muc3 T A 5: 137,142,298 T162S possibly damaging Het
Mup3 T A 4: 62,087,174 I20F possibly damaging Het
Nebl A C 2: 17,411,118 S327A probably benign Het
Nfatc4 A C 14: 55,826,644 D126A probably damaging Het
Nmt2 A T 2: 3,314,785 R271* probably null Het
Nol7 G A 13: 43,400,615 V133I probably benign Het
Olfr376 A T 11: 73,374,889 I47F probably benign Het
Olfr610 C T 7: 103,506,862 W28* probably null Het
Pde4d A T 13: 109,950,940 I670L probably damaging Het
Phlpp1 T A 1: 106,389,665 probably null Het
Pigz A G 16: 31,941,976 probably null Het
Prrg4 A T 2: 104,839,362 Y137N probably damaging Het
Rbm28 A T 6: 29,155,154 S217T possibly damaging Het
Ryr2 T C 13: 11,554,529 D4963G probably damaging Het
Slc35b2 T A 17: 45,566,825 F293I probably damaging Het
Slc35f1 A T 10: 53,089,347 Y286F probably damaging Het
Slc6a18 G T 13: 73,667,037 A384D probably damaging Het
St5 A G 7: 109,557,345 L66P probably damaging Het
Syt9 A G 7: 107,436,561 I262V probably damaging Het
Tln2 C A 9: 67,370,733 R333L probably damaging Het
Tnrc6b ACAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAG 15: 80,902,555 probably benign Het
Ttn G A 2: 76,751,066 T14834I possibly damaging Het
Uggt1 T C 1: 36,175,078 S177G probably benign Het
Zfp454 A G 11: 50,873,937 S223P probably benign Het
Zmat4 A G 8: 24,015,127 T128A probably benign Het
Other mutations in Dnase1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01718:Dnase1l2 APN 17 24441716 missense possibly damaging 0.52
IGL03123:Dnase1l2 APN 17 24442252 missense possibly damaging 0.71
IGL03052:Dnase1l2 UTSW 17 24440994 unclassified probably benign
R0035:Dnase1l2 UTSW 17 24441075 missense probably damaging 0.98
R0035:Dnase1l2 UTSW 17 24441075 missense probably damaging 0.98
R0646:Dnase1l2 UTSW 17 24441082 missense possibly damaging 0.94
R0743:Dnase1l2 UTSW 17 24441880 missense possibly damaging 0.92
R1017:Dnase1l2 UTSW 17 24442472 missense probably benign 0.03
R1988:Dnase1l2 UTSW 17 24441651 missense probably damaging 1.00
R2432:Dnase1l2 UTSW 17 24442725 missense possibly damaging 0.84
R5943:Dnase1l2 UTSW 17 24442747 missense probably damaging 0.98
R6228:Dnase1l2 UTSW 17 24442518 unclassified probably benign
R6353:Dnase1l2 UTSW 17 24442245 missense probably damaging 1.00
R7672:Dnase1l2 UTSW 17 24442245 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAATCGGCATTAAAGTCACCCAG -3'
(R):5'- TGAGCACGTACCAGTATCCAGACC -3'

Sequencing Primer
(F):5'- CCCAGAAACAGCATGTCCTG -3'
(R):5'- ACCCAGAGGACGCTTTCAG -3'
Posted On2013-11-07