Incidental Mutation 'R0884:Slc35b2'
ID81104
Institutional Source Beutler Lab
Gene Symbol Slc35b2
Ensembl Gene ENSMUSG00000037089
Gene Namesolute carrier family 35, member B2
SynonymsPAPST1, 1110003M08Rik
MMRRC Submission 039051-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R0884 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location45563874-45567671 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45566825 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 293 (F293I)
Ref Sequence ENSEMBL: ENSMUSP00000153367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024739] [ENSMUST00000024742] [ENSMUST00000041353] [ENSMUST00000130406] [ENSMUST00000163966] [ENSMUST00000165127] [ENSMUST00000166469] [ENSMUST00000223987] [ENSMUST00000224905] [ENSMUST00000226086]
Predicted Effect probably benign
Transcript: ENSMUST00000024739
SMART Domains Protein: ENSMUSP00000024739
Gene: ENSMUSG00000023944

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
HATPase_c 35 189 3.82e-10 SMART
Pfam:HSP90 191 719 5.4e-246 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000024742
SMART Domains Protein: ENSMUSP00000024742
Gene: ENSMUSG00000023947

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
low complexity region 93 110 N/A INTRINSIC
ANK 122 152 1.14e2 SMART
ANK 157 187 2.15e0 SMART
ANK 190 219 6.81e-3 SMART
ANK 233 262 5.09e-2 SMART
ANK 267 296 1.12e-3 SMART
ANK 300 329 1e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000041353
AA Change: F244I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037834
Gene: ENSMUSG00000037089
AA Change: F244I

DomainStartEndE-ValueType
Pfam:UAA 62 363 5.1e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130406
SMART Domains Protein: ENSMUSP00000119678
Gene: ENSMUSG00000023944

DomainStartEndE-ValueType
SCOP:d1byqa_ 9 76 2e-32 SMART
PDB:1UYM|A 14 76 7e-38 PDB
Blast:HATPase_c 35 76 3e-21 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145205
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146770
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151306
Predicted Effect probably benign
Transcript: ENSMUST00000163966
SMART Domains Protein: ENSMUSP00000131601
Gene: ENSMUSG00000023944

DomainStartEndE-ValueType
SCOP:d1byqa_ 9 85 9e-40 SMART
PDB:1UYM|A 14 85 3e-45 PDB
Blast:HATPase_c 35 85 9e-29 BLAST
low complexity region 93 107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165127
SMART Domains Protein: ENSMUSP00000126239
Gene: ENSMUSG00000023944

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:HSP90 37 161 3.8e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166469
SMART Domains Protein: ENSMUSP00000127338
Gene: ENSMUSG00000023944

DomainStartEndE-ValueType
Pfam:HSP90 4 189 1.3e-92 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000223987
AA Change: F244I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000224341
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224559
Predicted Effect probably damaging
Transcript: ENSMUST00000224905
AA Change: F293I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225226
Predicted Effect probably benign
Transcript: ENSMUST00000226086
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfotransferases (e.g., SULT4A1; MIM 608359) use an activated form of sulfate, 3-prime-phosphoadenosine 5-prime-phosphosulfate (PAPS), as a common sulfate donor for sulfation of glycoproteins, proteoglycans, and glycolipids in the endoplasmic reticulum and Golgi apparatus. SLC35B2 is located in the microsomal membrane and transports PAPS from the cytosol, where it is synthesized, into the Golgi lumen (Kamiyama et al., 2003 [PubMed 12716889]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 A T 14: 118,553,288 I844N possibly damaging Het
Acbd3 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA 1: 180,747,059 probably benign Het
Adam6b A T 12: 113,490,995 R477S probably damaging Het
Aqp7 T A 4: 41,034,929 T175S possibly damaging Het
Bclaf1 A T 10: 20,322,076 R22* probably null Het
Bend7 A T 2: 4,744,244 K57N probably damaging Het
Bicc1 A C 10: 70,958,847 V160G probably damaging Het
Cacna2d4 C T 6: 119,307,286 R745W probably damaging Het
Cep72 A G 13: 74,054,881 probably null Het
Cobl A G 11: 12,375,908 I196T possibly damaging Het
Cux1 T G 5: 136,307,835 D941A probably damaging Het
Cyp2a12 T C 7: 27,032,542 I236T probably benign Het
Depdc5 T A 5: 32,917,978 V500D possibly damaging Het
Dhx35 T C 2: 158,831,711 I354T probably damaging Het
Dnase1l2 A G 17: 24,441,880 V170A possibly damaging Het
Eif4g3 C A 4: 138,151,776 N588K possibly damaging Het
Epsti1 A T 14: 77,931,275 R117S probably damaging Het
Fam53a T C 5: 33,600,816 E321G probably benign Het
Fat4 C A 3: 38,982,858 T3553K possibly damaging Het
Fer1l4 T C 2: 156,019,313 T1978A possibly damaging Het
Gabarapl2 A T 8: 111,942,505 I32F probably damaging Het
Gje1 G T 10: 14,716,740 S99R possibly damaging Het
Gm13083 A G 4: 143,615,184 D61G probably benign Het
Gosr1 A G 11: 76,730,146 I239T probably benign Het
Gpnmb T C 6: 49,047,913 V293A possibly damaging Het
Hyi T A 4: 118,360,217 I62N probably damaging Het
Il4ra A G 7: 125,574,663 I267V probably damaging Het
Kcnd2 A T 6: 21,216,541 Q81H probably benign Het
Ksr1 A T 11: 79,021,503 H675Q possibly damaging Het
Lpcat4 A G 2: 112,242,732 N208S probably damaging Het
Muc3 T A 5: 137,142,298 T162S possibly damaging Het
Mup3 T A 4: 62,087,174 I20F possibly damaging Het
Nebl A C 2: 17,411,118 S327A probably benign Het
Nfatc4 A C 14: 55,826,644 D126A probably damaging Het
Nmt2 A T 2: 3,314,785 R271* probably null Het
Nol7 G A 13: 43,400,615 V133I probably benign Het
Olfr376 A T 11: 73,374,889 I47F probably benign Het
Olfr610 C T 7: 103,506,862 W28* probably null Het
Pde4d A T 13: 109,950,940 I670L probably damaging Het
Phlpp1 T A 1: 106,389,665 probably null Het
Pigz A G 16: 31,941,976 probably null Het
Prrg4 A T 2: 104,839,362 Y137N probably damaging Het
Rbm28 A T 6: 29,155,154 S217T possibly damaging Het
Ryr2 T C 13: 11,554,529 D4963G probably damaging Het
Slc35f1 A T 10: 53,089,347 Y286F probably damaging Het
Slc6a18 G T 13: 73,667,037 A384D probably damaging Het
St5 A G 7: 109,557,345 L66P probably damaging Het
Syt9 A G 7: 107,436,561 I262V probably damaging Het
Tln2 C A 9: 67,370,733 R333L probably damaging Het
Tnrc6b ACAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAG 15: 80,902,555 probably benign Het
Ttn G A 2: 76,751,066 T14834I possibly damaging Het
Uggt1 T C 1: 36,175,078 S177G probably benign Het
Zfp454 A G 11: 50,873,937 S223P probably benign Het
Zmat4 A G 8: 24,015,127 T128A probably benign Het
Other mutations in Slc35b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Slc35b2 APN 17 45564960 missense probably damaging 0.99
IGL02749:Slc35b2 APN 17 45566567 missense probably benign 0.14
IGL02951:Slc35b2 APN 17 45564768 missense probably damaging 1.00
IGL03382:Slc35b2 APN 17 45566645 missense probably damaging 0.98
R0020:Slc35b2 UTSW 17 45566856 missense probably damaging 1.00
R0368:Slc35b2 UTSW 17 45566463 missense probably benign
R0743:Slc35b2 UTSW 17 45566825 missense probably damaging 1.00
R2293:Slc35b2 UTSW 17 45567141 missense probably damaging 1.00
R3894:Slc35b2 UTSW 17 45566442 missense probably benign 0.01
R4372:Slc35b2 UTSW 17 45566429 missense probably benign 0.34
R4415:Slc35b2 UTSW 17 45566429 missense probably benign 0.34
R4416:Slc35b2 UTSW 17 45566429 missense probably benign 0.34
R4417:Slc35b2 UTSW 17 45566429 missense probably benign 0.34
R5291:Slc35b2 UTSW 17 45566498 missense probably damaging 1.00
R5314:Slc35b2 UTSW 17 45566498 missense probably damaging 1.00
R5929:Slc35b2 UTSW 17 45566661 missense probably benign 0.35
R6178:Slc35b2 UTSW 17 45566376 missense probably benign 0.10
R7217:Slc35b2 UTSW 17 45565029 missense probably benign 0.19
R7561:Slc35b2 UTSW 17 45566801 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGCAGCTATGAACACTGGGAATAC -3'
(R):5'- GACAGCAGCTCCAAATTGTCCAATG -3'

Sequencing Primer
(F):5'- CTATGAACACTGGGAATACCTGACTG -3'
(R):5'- GCTCCAAATTGTCCAATGGTGTAG -3'
Posted On2013-11-07