Mutagenetix > Incidental Mutations

Incidental Mutation 'R0975:Cyp2c67'

81117

Institutional Source

Beutler Lab

Gene Symbol

Cyp2c67

Ensembl Gene

ENSMUSG00000062624

Gene Name

cytochrome P450, family 2, subfamily c, polypeptide 67

Synonyms

C730004C24Rik

MMRRC Submission

039104-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.071) question?

Stock #

R0975 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

39608842-39649051 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 39609178 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamine at position 459 (K459Q)

Ref Sequence

ENSEMBL: ENSMUSP00000065796 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067328]

AlphaFold

Q569X9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000067328
AA Change: K459Q

PolyPhen 2 Score 0.490 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000065796
Gene: ENSMUSG00000062624
AA Change: K459Q

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:p450	30	487	8.5e-150	PFAM

Meta Mutation Damage Score

0.1222

Coding Region Coverage

1x: 99.5%
3x: 98.9%
10x: 97.6%
20x: 95.8%

Validation Efficiency

98% (52/53)

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ampd2	T	C	3: 108,077,121	Y464C	probably damaging	Het
Arap2	A	T	5: 62,730,886		probably benign	Het
Arhgap5	T	G	12: 52,517,144	N299K	possibly damaging	Het
Atl3	G	A	19: 7,521,135	W210*	probably null	Het
Bag1	T	C	4: 40,937,152	N320D	probably benign	Het
C530008M17Rik	T	C	5: 76,856,318		probably benign	Het
Ccdc39	T	C	3: 33,844,125	N24D	probably damaging	Het
Ccdc88b	G	A	19: 6,846,625	P1420L	probably damaging	Het
Cdr2	G	A	7: 120,958,391	P304S	probably benign	Het
Col20a1	A	T	2: 181,006,826	I969F	possibly damaging	Het
Coro1c	C	G	5: 113,882,121	R11P	probably damaging	Het
Cul7	T	A	17: 46,663,190	L1467H	probably damaging	Het
Cyp2c68	T	C	19: 39,703,358	T374A	possibly damaging	Het
Efcab6	T	A	15: 83,973,331	N289I	probably benign	Het
Elmo1	T	A	13: 20,251,137	I126N	probably damaging	Het
Esr2	C	T	12: 76,145,308	M315I	possibly damaging	Het
Fbxw14	T	A	9: 109,271,239	N449I	probably benign	Het
Frmpd1	C	T	4: 45,279,000	T575I	probably benign	Het
Gm14403	T	G	2: 177,509,424	N145K	probably damaging	Het
Gm5346	A	G	8: 43,625,118	F690L	probably benign	Het
Gnl2	A	G	4: 125,048,378	D392G	probably damaging	Het
Hmcn1	A	C	1: 150,577,377	S5396A	probably benign	Het
Hoxd12	G	T	2: 74,675,934	R230L	probably damaging	Het
Khsrp	T	A	17: 57,027,066	D154V	possibly damaging	Het
Klhl28	C	T	12: 64,951,688	R344H	possibly damaging	Het
Klhl3	C	T	13: 58,013,863	V473M	possibly damaging	Het
Larp1b	A	G	3: 40,970,490	E134G	probably damaging	Het
Mcm9	G	A	10: 53,538,646	Q113*	probably null	Het
Mug1	A	T	6: 121,878,539	D944V	probably damaging	Het
Myh6	A	G	14: 54,953,369	S950P	probably damaging	Het
Nfix	G	A	8: 84,726,526	R300C	probably damaging	Het
Olfr177	T	A	16: 58,873,150		probably null	Het
Olfr353	C	A	2: 36,890,550	M99I	possibly damaging	Het
Plcb4	T	C	2: 135,987,912		probably benign	Het
Pomt1	T	A	2: 32,253,895		probably null	Het
Ppil2	T	A	16: 17,107,213	T32S	probably benign	Het
Prpf8	T	C	11: 75,508,674		probably benign	Het
Rad9b	C	T	5: 122,334,257		probably null	Het
Recql5	A	C	11: 115,923,256	D240E	probably damaging	Het
Sec31a	A	C	5: 100,395,904		probably null	Het
Slc5a4b	A	G	10: 76,081,407	V265A	probably benign	Het
Snx29	A	T	16: 11,347,871	D7V	possibly damaging	Het
Stk31	C	G	6: 49,423,409	D389E	probably damaging	Het
Tmeff2	T	C	1: 50,938,205		probably benign	Het
Tmem131	C	T	1: 36,854,885	A146T	probably damaging	Het
Tmem63c	T	A	12: 87,075,069		probably benign	Het
Tonsl	T	A	15: 76,638,932	D119V	probably damaging	Het
Trmt10a	G	A	3: 138,156,809	E287K	probably benign	Het
Vmn1r192	T	A	13: 22,187,463	M196L	probably damaging	Het
Vmn2r9	T	G	5: 108,843,303	T731P	probably damaging	Het
Wfdc6b	G	A	2: 164,613,785	M11I	probably damaging	Het
Zfp827	A	G	8: 79,061,185	T327A	probably benign	Het

Other mutations in Cyp2c67

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00955:Cyp2c67	APN	19	39643385	missense	possibly damaging	0.95
IGL01025:Cyp2c67	APN	19	39639932	nonsense	probably null
IGL01363:Cyp2c67	APN	19	39639967	missense	probably damaging	0.99
IGL01819:Cyp2c67	APN	19	39615721	missense	probably damaging	0.98
IGL01902:Cyp2c67	APN	19	39649026	missense	probably damaging	1.00
IGL02172:Cyp2c67	APN	19	39649002	missense	possibly damaging	0.76
IGL02351:Cyp2c67	APN	19	39617417	missense	probably damaging	1.00
IGL02355:Cyp2c67	APN	19	39643405	missense	probably benign	0.34
IGL02355:Cyp2c67	APN	19	39617382	nonsense	probably null
IGL02358:Cyp2c67	APN	19	39617417	missense	probably damaging	1.00
IGL02362:Cyp2c67	APN	19	39643405	missense	probably benign	0.34
IGL02362:Cyp2c67	APN	19	39617382	nonsense	probably null
IGL02388:Cyp2c67	APN	19	39643355	missense	probably benign	0.20
IGL03106:Cyp2c67	APN	19	39643675	missense	probably benign	0.27
IGL03219:Cyp2c67	APN	19	39643294	missense	possibly damaging	0.54
IGL03326:Cyp2c67	APN	19	39643269	critical splice donor site	probably null
IGL03349:Cyp2c67	APN	19	39643684	missense	probably damaging	1.00
IGL03356:Cyp2c67	APN	19	39639961	missense	probably damaging	1.00
IGL03052:Cyp2c67	UTSW	19	39648885	missense	possibly damaging	0.88
R0585:Cyp2c67	UTSW	19	39638694	missense	possibly damaging	0.59
R0976:Cyp2c67	UTSW	19	39643374	missense	probably damaging	1.00
R1252:Cyp2c67	UTSW	19	39626141	missense	possibly damaging	0.93
R1398:Cyp2c67	UTSW	19	39638625	missense	probably damaging	0.96
R1411:Cyp2c67	UTSW	19	39638591	missense	probably damaging	1.00
R1505:Cyp2c67	UTSW	19	39648964	missense	probably benign	0.00
R1543:Cyp2c67	UTSW	19	39643264	splice site	probably benign
R1613:Cyp2c67	UTSW	19	39626199	missense	probably benign	0.00
R1618:Cyp2c67	UTSW	19	39643264	splice site	probably benign
R1667:Cyp2c67	UTSW	19	39643590	critical splice donor site	probably null
R1852:Cyp2c67	UTSW	19	39617367	missense	probably benign	0.01
R2005:Cyp2c67	UTSW	19	39643345	missense	probably damaging	1.00
R2105:Cyp2c67	UTSW	19	39626237	missense	probably benign	0.24
R2181:Cyp2c67	UTSW	19	39609097	missense	possibly damaging	0.94
R3817:Cyp2c67	UTSW	19	39638683	missense	probably benign	0.00
R4669:Cyp2c67	UTSW	19	39643654	missense	probably benign	0.00
R4689:Cyp2c67	UTSW	19	39638588	missense	probably benign	0.00
R4756:Cyp2c67	UTSW	19	39643744	missense	probably benign	0.03
R4823:Cyp2c67	UTSW	19	39615724	missense	probably benign	0.13
R5152:Cyp2c67	UTSW	19	39638688	missense	probably benign	0.00
R5345:Cyp2c67	UTSW	19	39626232	missense	probably benign	0.01
R5580:Cyp2c67	UTSW	19	39615650	missense	probably damaging	0.99
R5644:Cyp2c67	UTSW	19	39615694	missense	possibly damaging	0.84
R6116:Cyp2c67	UTSW	19	39617435	missense	probably damaging	1.00
R6516:Cyp2c67	UTSW	19	39617429	missense	probably damaging	1.00
R6550:Cyp2c67	UTSW	19	39617410	nonsense	probably null
R6939:Cyp2c67	UTSW	19	39643334	missense	possibly damaging	0.68
R6995:Cyp2c67	UTSW	19	39615679	missense	probably damaging	0.96
R7028:Cyp2c67	UTSW	19	39639897	missense	possibly damaging	0.68
R7144:Cyp2c67	UTSW	19	39615694	missense	probably benign	0.00
R7242:Cyp2c67	UTSW	19	39617339	missense	probably benign	0.30
R7335:Cyp2c67	UTSW	19	39640007	nonsense	probably null
R7337:Cyp2c67	UTSW	19	39609264	splice site	probably null
R7474:Cyp2c67	UTSW	19	39617432	missense	probably null	0.05
R7642:Cyp2c67	UTSW	19	39615640	missense	probably damaging	0.97
R7870:Cyp2c67	UTSW	19	39609225	missense	probably damaging	1.00
R8152:Cyp2c67	UTSW	19	39640008	missense	probably benign	0.21
R8367:Cyp2c67	UTSW	19	39638674	missense	probably benign	0.01
R8717:Cyp2c67	UTSW	19	39638711	missense	probably benign	0.05
R8728:Cyp2c67	UTSW	19	39626161	missense	probably damaging	1.00
R9275:Cyp2c67	UTSW	19	39609255	missense	probably damaging	1.00
R9278:Cyp2c67	UTSW	19	39609255	missense	probably damaging	1.00
R9376:Cyp2c67	UTSW	19	39638734	missense	probably damaging	1.00
Z1177:Cyp2c67	UTSW	19	39643679	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- TGTTAGCCTTGGGCAATTAGAGAACAG -3'
(R):5'- ACACAGTGCCTCTCAAACTCACTTATG -3'

Sequencing Primer
(F):5'- ACTGTGTTAAATGAGGGCTTCC -3'
(R):5'- CTCTCAAACTCACTTATGTACGAG -3'

Posted On

2013-11-07