Incidental Mutation 'R0976:Nek2'
ID81129
Institutional Source Beutler Lab
Gene Symbol Nek2
Ensembl Gene ENSMUSG00000026622
Gene NameNIMA (never in mitosis gene a)-related expressed kinase 2
Synonyms
MMRRC Submission 039105-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0976 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location191821444-191833050 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 191827237 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 285 (R285G)
Ref Sequence ENSEMBL: ENSMUSP00000027931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027931]
Predicted Effect probably benign
Transcript: ENSMUST00000027931
AA Change: R285G

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000027931
Gene: ENSMUSG00000026622
AA Change: R285G

DomainStartEndE-ValueType
S_TKc 8 271 5.59e-86 SMART
low complexity region 277 292 N/A INTRINSIC
coiled coil region 339 355 N/A INTRINSIC
low complexity region 414 426 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136733
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150839
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 97.6%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine-protein kinase that is involved in mitotic regulation. This protein is localized to the centrosome, and undetectable during G1 phase, but accumulates progressively throughout the S phase, reaching maximal levels in late G2 phase. Alternatively spliced transcript variants encoding different isoforms with distinct C-termini have been noted for this gene. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,505 S119N probably benign Het
Arap2 T A 5: 62,649,884 I1147F probably damaging Het
Arl10 T C 13: 54,575,808 probably benign Het
Axin1 A G 17: 26,188,086 E551G probably damaging Het
Ccr6 T A 17: 8,256,422 L153Q probably damaging Het
Cntnap2 C T 6: 47,271,230 P1190L probably damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Cux1 T A 5: 136,313,290 D416V probably damaging Het
Cyp2c67 G T 19: 39,643,374 F126L probably damaging Het
Cyp3a57 A G 5: 145,390,468 I490V probably benign Het
Dsc1 T C 18: 20,095,041 probably null Het
Fam83f T A 15: 80,692,084 V312E probably damaging Het
Fsip2 A G 2: 82,998,031 D6724G possibly damaging Het
Gabrr3 G T 16: 59,461,524 C414F probably benign Het
Gm21738 T C 14: 19,415,963 K192R probably benign Het
Herc1 A T 9: 66,439,878 K2005M possibly damaging Het
Hist2h2bb T A 3: 96,270,086 V112E probably benign Het
Isyna1 C A 8: 70,596,286 N338K probably damaging Het
Kalrn T C 16: 34,385,390 D39G probably damaging Het
Mndal T A 1: 173,862,845 R306S possibly damaging Het
Nrg2 A G 18: 36,021,091 I591T probably benign Het
Olfr52 A G 2: 86,181,808 L101S probably damaging Het
Pcdh10 T C 3: 45,380,801 S517P probably damaging Het
Pdcd2l G T 7: 34,196,346 D67E probably benign Het
Pex1 C A 5: 3,633,943 D1146E probably benign Het
Pid1 A T 1: 84,159,225 Y62N probably benign Het
Ppp4r1 T C 17: 65,841,018 *935R probably null Het
Stag1 T C 9: 100,776,824 F155L probably damaging Het
Stag1 G A 9: 100,930,016 probably null Het
Taok2 C T 7: 126,875,151 R302Q possibly damaging Het
Tbc1d8 A G 1: 39,406,801 V103A probably damaging Het
Terf2ip T A 8: 112,011,717 I79N probably damaging Het
Tgfb3 G A 12: 86,069,832 T144I probably damaging Het
Top1 A G 2: 160,717,423 N622S possibly damaging Het
Trappc9 T A 15: 72,999,974 Q489L probably damaging Het
Vmn2r69 T C 7: 85,406,900 T677A probably damaging Het
Wdr35 T C 12: 8,986,104 F292L probably benign Het
Other mutations in Nek2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Nek2 APN 1 191827378 splice site probably benign
IGL01753:Nek2 APN 1 191825486 nonsense probably null
IGL02086:Nek2 APN 1 191831289 missense probably benign 0.03
IGL02164:Nek2 APN 1 191827304 missense probably benign 0.01
IGL02550:Nek2 APN 1 191822259 missense probably damaging 1.00
R0398:Nek2 UTSW 1 191827361 missense probably benign
R0610:Nek2 UTSW 1 191822515 missense probably damaging 1.00
R0629:Nek2 UTSW 1 191831317 missense probably benign 0.14
R0646:Nek2 UTSW 1 191822219 missense probably damaging 1.00
R2054:Nek2 UTSW 1 191821652 missense possibly damaging 0.79
R2112:Nek2 UTSW 1 191827208 missense probably benign 0.08
R3873:Nek2 UTSW 1 191827208 missense probably benign 0.08
R4461:Nek2 UTSW 1 191822715 missense probably damaging 1.00
R5947:Nek2 UTSW 1 191829485 missense probably benign 0.17
R6807:Nek2 UTSW 1 191822617 missense probably damaging 0.98
R8032:Nek2 UTSW 1 191826345 missense probably damaging 0.96
R8692:Nek2 UTSW 1 191822633 missense probably benign 0.00
Z1176:Nek2 UTSW 1 191827239 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AAACTCAGGTCATGGTGCAGACCC -3'
(R):5'- TTGGTAACACAAGCCGCTGGAG -3'

Sequencing Primer
(F):5'- CCTGATATCTCTAGATGCAGGAACTG -3'
(R):5'- aatccccagaacccacaac -3'
Posted On2013-11-07