Incidental Mutation 'R0976:Hist2h2bb'
ID81143
Institutional Source Beutler Lab
Gene Symbol Hist2h2bb
Ensembl Gene ENSMUSG00000105827
Gene Namehistone cluster 2, H2bb
SynonymsH2b-616
MMRRC Submission 039105-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.340) question?
Stock #R0976 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location96269752-96270132 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 96270086 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 112 (V112E)
Ref Sequence ENSEMBL: ENSMUSP00000135427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098843] [ENSMUST00000177113]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000051089
SMART Domains Protein: ENSMUSP00000059105
Gene: ENSMUSG00000050936

DomainStartEndE-ValueType
H2B 28 112 1.48e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098843
SMART Domains Protein: ENSMUSP00000096442
Gene: ENSMUSG00000074403

DomainStartEndE-ValueType
H3 34 136 2.12e-75 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177113
AA Change: V112E

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000135427
Gene: ENSMUSG00000105827
AA Change: V112E

DomainStartEndE-ValueType
H2B 28 124 1.43e-72 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193036
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 97.6%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene encodes a replication-dependent histone that is a member of the histone H2B family. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,505 S119N probably benign Het
Arap2 T A 5: 62,649,884 I1147F probably damaging Het
Arl10 T C 13: 54,575,808 probably benign Het
Axin1 A G 17: 26,188,086 E551G probably damaging Het
Ccr6 T A 17: 8,256,422 L153Q probably damaging Het
Cntnap2 C T 6: 47,271,230 P1190L probably damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Cux1 T A 5: 136,313,290 D416V probably damaging Het
Cyp2c67 G T 19: 39,643,374 F126L probably damaging Het
Cyp3a57 A G 5: 145,390,468 I490V probably benign Het
Dsc1 T C 18: 20,095,041 probably null Het
Fam83f T A 15: 80,692,084 V312E probably damaging Het
Fsip2 A G 2: 82,998,031 D6724G possibly damaging Het
Gabrr3 G T 16: 59,461,524 C414F probably benign Het
Gm21738 T C 14: 19,415,963 K192R probably benign Het
Herc1 A T 9: 66,439,878 K2005M possibly damaging Het
Isyna1 C A 8: 70,596,286 N338K probably damaging Het
Kalrn T C 16: 34,385,390 D39G probably damaging Het
Mndal T A 1: 173,862,845 R306S possibly damaging Het
Nek2 A G 1: 191,827,237 R285G probably benign Het
Nrg2 A G 18: 36,021,091 I591T probably benign Het
Olfr52 A G 2: 86,181,808 L101S probably damaging Het
Pcdh10 T C 3: 45,380,801 S517P probably damaging Het
Pdcd2l G T 7: 34,196,346 D67E probably benign Het
Pex1 C A 5: 3,633,943 D1146E probably benign Het
Pid1 A T 1: 84,159,225 Y62N probably benign Het
Ppp4r1 T C 17: 65,841,018 *935R probably null Het
Stag1 T C 9: 100,776,824 F155L probably damaging Het
Stag1 G A 9: 100,930,016 probably null Het
Taok2 C T 7: 126,875,151 R302Q possibly damaging Het
Tbc1d8 A G 1: 39,406,801 V103A probably damaging Het
Terf2ip T A 8: 112,011,717 I79N probably damaging Het
Tgfb3 G A 12: 86,069,832 T144I probably damaging Het
Top1 A G 2: 160,717,423 N622S possibly damaging Het
Trappc9 T A 15: 72,999,974 Q489L probably damaging Het
Vmn2r69 T C 7: 85,406,900 T677A probably damaging Het
Wdr35 T C 12: 8,986,104 F292L probably benign Het
Other mutations in Hist2h2bb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01474:Hist2h2bb APN 3 96269809 unclassified probably benign
R0357:Hist2h2bb UTSW 3 96269788 missense probably null 0.04
R0882:Hist2h2bb UTSW 3 96269744 splice site probably null
R1473:Hist2h2bb UTSW 3 96270072 missense probably damaging 1.00
R1507:Hist2h2bb UTSW 3 96269873 missense probably damaging 1.00
R4503:Hist2h2bb UTSW 3 96269924 missense possibly damaging 0.84
R4751:Hist2h2bb UTSW 3 96269151 unclassified probably benign
R4808:Hist2h2bb UTSW 3 96270013 missense probably benign 0.00
R6118:Hist2h2bb UTSW 3 96269951 missense probably damaging 1.00
R6585:Hist2h2bb UTSW 3 96270097 missense probably benign 0.17
R7527:Hist2h2bb UTSW 3 96269870 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AAGTCTGCTCCTGCCCCAAAGAAG -3'
(R):5'- TTTGAAACGCTCGATGTTGCACC -3'

Sequencing Primer
(F):5'- CGCAAGGAGAGCTATTCTGTTTAC -3'
(R):5'- TGCAGGGTAACAGACTCATC -3'
Posted On2013-11-07