Incidental Mutation 'R0976:Pex1'
ID81146
Institutional Source Beutler Lab
Gene Symbol Pex1
Ensembl Gene ENSMUSG00000005907
Gene Nameperoxisomal biogenesis factor 1
Synonymsperoxisome biogenesis factor 1, ZWS1
MMRRC Submission 039105-MU
Accession Numbers

Genbank: NM_027777

Is this an essential gene? Possibly non essential (E-score: 0.469) question?
Stock #R0976 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location3596066-3637232 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 3633943 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1146 (D1146E)
Ref Sequence ENSEMBL: ENSMUSP00000113304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006061] [ENSMUST00000121291] [ENSMUST00000140871]
Predicted Effect probably benign
Transcript: ENSMUST00000006061
AA Change: D1106E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000006061
Gene: ENSMUSG00000005907
AA Change: D1106E

DomainStartEndE-ValueType
Pfam:PEX-2N 14 99 2.4e-53 PFAM
Pfam:PEX-1N 103 179 8.6e-27 PFAM
low complexity region 508 527 N/A INTRINSIC
AAA 552 702 1.39e-10 SMART
low complexity region 754 765 N/A INTRINSIC
AAA 834 970 4.07e-17 SMART
low complexity region 1024 1044 N/A INTRINSIC
low complexity region 1051 1061 N/A INTRINSIC
low complexity region 1065 1078 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121291
AA Change: D1146E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113304
Gene: ENSMUSG00000005907
AA Change: D1146E

DomainStartEndE-ValueType
Pfam:PEX-2N 17 98 8.7e-38 PFAM
Pfam:PEX-1N 104 179 1.4e-27 PFAM
low complexity region 548 567 N/A INTRINSIC
AAA 592 742 1.39e-10 SMART
low complexity region 794 805 N/A INTRINSIC
AAA 874 1010 4.07e-17 SMART
low complexity region 1064 1084 N/A INTRINSIC
low complexity region 1091 1101 N/A INTRINSIC
low complexity region 1105 1118 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140871
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196432
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197167
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199213
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199632
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 97.6%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AAA ATPase family, a large group of ATPases associated with diverse cellular activities. This protein is cytoplasmic but is often anchored to a peroxisomal membrane where it forms a heteromeric complex and plays a role in the import of proteins into peroxisomes and peroxisome biogenesis. Mutations in this gene have been associated with complementation group 1 peroxisomal disorders such as neonatal adrenoleukodystrophy, infantile Refsum disease, and Zellweger syndrome. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-in allele display premature death, postnatal growth retardation, fatty livers, a bile acid defect associated with intestinal lipid malabsorption and cholestasis, and a retinopathy associated with retinal cone cell degenerationand abnormal cone and rod electrophysiology. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, other(2) Gene trapped(2)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,505 S119N probably benign Het
Arap2 T A 5: 62,649,884 I1147F probably damaging Het
Arl10 T C 13: 54,575,808 probably benign Het
Axin1 A G 17: 26,188,086 E551G probably damaging Het
Ccr6 T A 17: 8,256,422 L153Q probably damaging Het
Cntnap2 C T 6: 47,271,230 P1190L probably damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Cux1 T A 5: 136,313,290 D416V probably damaging Het
Cyp2c67 G T 19: 39,643,374 F126L probably damaging Het
Cyp3a57 A G 5: 145,390,468 I490V probably benign Het
Dsc1 T C 18: 20,095,041 probably null Het
Fam83f T A 15: 80,692,084 V312E probably damaging Het
Fsip2 A G 2: 82,998,031 D6724G possibly damaging Het
Gabrr3 G T 16: 59,461,524 C414F probably benign Het
Gm21738 T C 14: 19,415,963 K192R probably benign Het
Herc1 A T 9: 66,439,878 K2005M possibly damaging Het
Hist2h2bb T A 3: 96,270,086 V112E probably benign Het
Isyna1 C A 8: 70,596,286 N338K probably damaging Het
Kalrn T C 16: 34,385,390 D39G probably damaging Het
Mndal T A 1: 173,862,845 R306S possibly damaging Het
Nek2 A G 1: 191,827,237 R285G probably benign Het
Nrg2 A G 18: 36,021,091 I591T probably benign Het
Olfr52 A G 2: 86,181,808 L101S probably damaging Het
Pcdh10 T C 3: 45,380,801 S517P probably damaging Het
Pdcd2l G T 7: 34,196,346 D67E probably benign Het
Pid1 A T 1: 84,159,225 Y62N probably benign Het
Ppp4r1 T C 17: 65,841,018 *935R probably null Het
Stag1 G A 9: 100,930,016 probably null Het
Stag1 T C 9: 100,776,824 F155L probably damaging Het
Taok2 C T 7: 126,875,151 R302Q possibly damaging Het
Tbc1d8 A G 1: 39,406,801 V103A probably damaging Het
Terf2ip T A 8: 112,011,717 I79N probably damaging Het
Tgfb3 G A 12: 86,069,832 T144I probably damaging Het
Top1 A G 2: 160,717,423 N622S possibly damaging Het
Trappc9 T A 15: 72,999,974 Q489L probably damaging Het
Vmn2r69 T C 7: 85,406,900 T677A probably damaging Het
Wdr35 T C 12: 8,986,104 F292L probably benign Het
Other mutations in Pex1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Pex1 APN 5 3606027 missense probably benign 0.00
IGL01315:Pex1 APN 5 3609975 missense probably damaging 1.00
IGL01671:Pex1 APN 5 3624088 missense probably benign 0.00
IGL01863:Pex1 APN 5 3606066 missense probably benign 0.01
IGL01933:Pex1 APN 5 3633789 missense probably damaging 1.00
IGL01960:Pex1 APN 5 3627588 unclassified probably benign
IGL02347:Pex1 APN 5 3603350 missense probably damaging 0.98
IGL02374:Pex1 APN 5 3635481 missense probably benign 0.01
IGL02392:Pex1 APN 5 3605952 nonsense probably null
IGL02597:Pex1 APN 5 3635865 missense possibly damaging 0.50
IGL02703:Pex1 APN 5 3615120 missense probably benign 0.24
IGL02815:Pex1 APN 5 3636797 missense probably damaging 0.97
IGL02862:Pex1 APN 5 3605424 intron probably benign
IGL03005:Pex1 APN 5 3630292 missense probably null 0.96
E0370:Pex1 UTSW 5 3631614 splice site probably null
F5493:Pex1 UTSW 5 3635912 critical splice donor site probably null
R0014:Pex1 UTSW 5 3626141 unclassified probably benign
R0014:Pex1 UTSW 5 3626141 unclassified probably benign
R0401:Pex1 UTSW 5 3633759 missense probably damaging 1.00
R0480:Pex1 UTSW 5 3606444 splice site probably null
R0555:Pex1 UTSW 5 3606130 missense possibly damaging 0.89
R1200:Pex1 UTSW 5 3606411 critical splice donor site probably null
R1672:Pex1 UTSW 5 3626085 missense probably damaging 1.00
R1753:Pex1 UTSW 5 3630044 missense probably damaging 1.00
R1880:Pex1 UTSW 5 3605770 missense probably benign
R1953:Pex1 UTSW 5 3630038 missense probably damaging 1.00
R2054:Pex1 UTSW 5 3603341 missense possibly damaging 0.78
R2081:Pex1 UTSW 5 3624132 critical splice donor site probably null
R2237:Pex1 UTSW 5 3618915 critical splice donor site probably null
R3946:Pex1 UTSW 5 3626084 missense probably damaging 1.00
R4528:Pex1 UTSW 5 3631712 missense probably damaging 1.00
R4579:Pex1 UTSW 5 3618880 missense probably benign 0.03
R4585:Pex1 UTSW 5 3633885 missense probably damaging 1.00
R4586:Pex1 UTSW 5 3633885 missense probably damaging 1.00
R4656:Pex1 UTSW 5 3604880 critical splice donor site probably null
R4789:Pex1 UTSW 5 3630270 missense probably damaging 0.98
R4850:Pex1 UTSW 5 3624426 missense probably benign
R4963:Pex1 UTSW 5 3609924 missense probably benign 0.01
R5005:Pex1 UTSW 5 3622310 missense probably damaging 1.00
R5015:Pex1 UTSW 5 3620597 missense probably damaging 1.00
R5019:Pex1 UTSW 5 3622331 missense probably damaging 1.00
R5937:Pex1 UTSW 5 3624487 missense possibly damaging 0.94
R5942:Pex1 UTSW 5 3610277 missense probably benign 0.04
R5995:Pex1 UTSW 5 3607704 missense possibly damaging 0.53
R6434:Pex1 UTSW 5 3630196 nonsense probably null
R6552:Pex1 UTSW 5 3623953 missense probably damaging 1.00
R6777:Pex1 UTSW 5 3622358 missense probably benign 0.01
R6877:Pex1 UTSW 5 3635505 missense probably benign 0.19
R6948:Pex1 UTSW 5 3605994 missense probably benign 0.00
R7317:Pex1 UTSW 5 3618875 missense probably damaging 1.00
R7408:Pex1 UTSW 5 3630222 missense probably damaging 1.00
R7658:Pex1 UTSW 5 3596244 unclassified probably benign
R8062:Pex1 UTSW 5 3605656 missense probably benign
R8366:Pex1 UTSW 5 3626007 missense probably benign 0.00
X0019:Pex1 UTSW 5 3605653 missense probably damaging 1.00
X0027:Pex1 UTSW 5 3630270 missense probably damaging 0.98
Z1088:Pex1 UTSW 5 3606075 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CTGGCCCTCTCCGTGTGTAATTTAG -3'
(R):5'- GTCCCTGTGGAACCAATCTTGCTC -3'

Sequencing Primer
(F):5'- CTCTGACAGTGACCTGAGTCTG -3'
(R):5'- ACCAATCTTGCTCCTGTTATAAATG -3'
Posted On2013-11-07