Incidental Mutation 'R0885:Ptpn5'
ID81149
Institutional Source Beutler Lab
Gene Symbol Ptpn5
Ensembl Gene ENSMUSG00000030854
Gene Nameprotein tyrosine phosphatase, non-receptor type 5
SynonymsStep
MMRRC Submission 039052-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0885 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location47077795-47133684 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 47088611 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 241 (Y241C)
Ref Sequence ENSEMBL: ENSMUSP00000099686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033142] [ENSMUST00000102626]
Predicted Effect probably benign
Transcript: ENSMUST00000033142
AA Change: Y241C

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000033142
Gene: ENSMUSG00000030854
AA Change: Y241C

DomainStartEndE-ValueType
low complexity region 26 51 N/A INTRINSIC
low complexity region 121 138 N/A INTRINSIC
low complexity region 141 155 N/A INTRINSIC
PTPc 275 533 2.39e-115 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102626
AA Change: Y241C

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000099686
Gene: ENSMUSG00000030854
AA Change: Y241C

DomainStartEndE-ValueType
low complexity region 26 51 N/A INTRINSIC
low complexity region 121 138 N/A INTRINSIC
low complexity region 141 155 N/A INTRINSIC
PTPc 275 533 2.39e-115 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207172
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208324
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208437
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208531
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209161
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit normal brain development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 T C 8: 24,651,786 K256E probably damaging Het
Adam20 T A 8: 40,796,558 H568Q probably benign Het
Ambp A G 4: 63,151,468 L107P probably damaging Het
Art1 T C 7: 102,107,334 F244S probably damaging Het
Asxl2 C A 12: 3,501,458 L1067I probably damaging Het
Atm T C 9: 53,459,823 T2242A probably benign Het
Atp2c1 C T 9: 105,421,573 probably null Het
Bptf A G 11: 107,043,791 Y2819H probably damaging Het
Caskin1 G A 17: 24,505,694 R1152H probably damaging Het
Chd7 T A 4: 8,866,432 L868Q probably damaging Het
Cyp2d40 T C 15: 82,760,915 E178G unknown Het
Dclk1 G T 3: 55,487,307 R103S probably damaging Het
Des A G 1: 75,360,730 T105A probably damaging Het
Ebf3 T C 7: 137,225,884 T262A probably benign Het
Epha4 A G 1: 77,382,939 V759A probably damaging Het
Fam192a C A 8: 94,575,779 C208F probably damaging Het
Fryl A T 5: 73,089,196 F1078I probably damaging Het
Il20 T C 1: 130,910,781 I60V probably benign Het
Kif3c A T 12: 3,365,981 M1L probably benign Het
Lhfpl5 A T 17: 28,576,037 I13F probably damaging Het
Lin28b C T 10: 45,381,228 G218E probably damaging Het
Lrp2 A T 2: 69,482,353 N2530K possibly damaging Het
Matn2 T A 15: 34,316,605 F31Y possibly damaging Het
Mcm6 T C 1: 128,348,933 N307D probably benign Het
Mmp16 A T 4: 18,054,491 R332S probably benign Het
Mpdz T A 4: 81,369,592 T477S probably benign Het
Mrgprb3 C A 7: 48,643,096 G236W probably damaging Het
Mrpl47 T C 3: 32,730,186 D145G probably damaging Het
Myo6 T C 9: 80,242,221 S150P probably damaging Het
Naca C A 10: 128,040,179 S360* probably null Het
Olfr319 C T 11: 58,702,087 P129S possibly damaging Het
Phip C A 9: 82,875,395 A1575S probably benign Het
Plxna2 T C 1: 194,644,556 M266T probably benign Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Prag1 T C 8: 36,103,267 F335L probably benign Het
Prmt2 A G 10: 76,222,565 Y137H probably damaging Het
Ptgds T C 2: 25,467,345 D184G possibly damaging Het
Pxdn G A 12: 30,003,402 V1193M probably benign Het
Raet1e T A 10: 22,182,087 probably benign Het
Rttn A G 18: 88,983,810 D282G probably benign Het
Sis G A 3: 72,911,949 R1425* probably null Het
Slco2a1 G T 9: 103,082,383 M559I probably damaging Het
Spata4 C T 8: 54,600,844 A15V probably damaging Het
Spop T C 11: 95,470,627 S14P probably benign Het
Tcof1 A T 18: 60,835,850 D230E possibly damaging Het
Thap8 T A 7: 30,280,669 Y46* probably null Het
Tmem55b T C 14: 50,930,306 E54G probably damaging Het
Tubgcp5 T A 7: 55,806,055 L277* probably null Het
Ubxn10 A T 4: 138,720,570 V265E probably damaging Het
Ugt2b36 T A 5: 87,091,989 Y179F probably benign Het
Wdr37 A C 13: 8,835,252 probably null Het
Zfp593 A G 4: 134,244,913 V94A probably benign Het
Other mutations in Ptpn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01508:Ptpn5 APN 7 47091555 missense probably benign 0.00
IGL01557:Ptpn5 APN 7 47081888 missense probably damaging 1.00
IGL01691:Ptpn5 APN 7 47083158 missense probably benign 0.27
IGL02051:Ptpn5 APN 7 47082759 critical splice donor site probably null
PIT4696001:Ptpn5 UTSW 7 47088606 missense probably benign
R0309:Ptpn5 UTSW 7 47079294 missense probably damaging 0.97
R0325:Ptpn5 UTSW 7 47090758 missense probably benign
R0325:Ptpn5 UTSW 7 47090759 missense probably benign
R0414:Ptpn5 UTSW 7 47083136 missense probably benign
R0570:Ptpn5 UTSW 7 47078933 splice site probably benign
R1311:Ptpn5 UTSW 7 47079232 splice site probably benign
R1501:Ptpn5 UTSW 7 47089875 missense probably benign 0.26
R1772:Ptpn5 UTSW 7 47090768 missense probably benign 0.00
R1815:Ptpn5 UTSW 7 47078841 missense probably benign
R1913:Ptpn5 UTSW 7 47078868 missense possibly damaging 0.92
R2109:Ptpn5 UTSW 7 47086059 missense probably damaging 0.99
R2112:Ptpn5 UTSW 7 47083142 missense probably benign 0.00
R2184:Ptpn5 UTSW 7 47088602 missense probably damaging 0.99
R4244:Ptpn5 UTSW 7 47091548 nonsense probably null
R4551:Ptpn5 UTSW 7 47090852 intron probably benign
R5353:Ptpn5 UTSW 7 47081894 missense probably benign 0.03
R5897:Ptpn5 UTSW 7 47079514 missense probably benign 0.41
R6442:Ptpn5 UTSW 7 47083083 splice site probably null
R7549:Ptpn5 UTSW 7 47086126 critical splice acceptor site probably null
Z1176:Ptpn5 UTSW 7 47086122 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCACTACATGGACAATGGTGGAG -3'
(R):5'- TCCTAGCAGAGATGCACTTGACCC -3'

Sequencing Primer
(F):5'- AAGGGTCCAGAGCCTTTTCA -3'
(R):5'- TGCTACTGAAGTCTGAAGTCC -3'
Posted On2013-11-07