Incidental Mutation 'R0976:Arap2'
ID 81150
Institutional Source Beutler Lab
Gene Symbol Arap2
Ensembl Gene ENSMUSG00000037999
Gene Name ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2
Synonyms Centd1
MMRRC Submission 039105-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0976 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 62759788-62923502 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 62807227 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1147 (I1147F)
Ref Sequence ENSEMBL: ENSMUSP00000075924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076623]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000076623
AA Change: I1147F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075924
Gene: ENSMUSG00000037999
AA Change: I1147F

DomainStartEndE-ValueType
SAM 3 70 3.69e-7 SMART
low complexity region 222 233 N/A INTRINSIC
PH 481 574 6.45e-17 SMART
PH 586 679 9.05e-12 SMART
ArfGap 684 805 9.2e-33 SMART
PH 891 1003 1.51e-8 SMART
PH 1013 1112 9.21e-4 SMART
RhoGAP 1124 1300 1.36e-50 SMART
Pfam:RA 1325 1416 2.1e-7 PFAM
PH 1429 1533 2.68e-14 SMART
coiled coil region 1561 1590 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160419
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 97.6%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains ARF-GAP, RHO-GAP, ankyrin repeat, RAS-associating, and pleckstrin homology domains. The protein is a phosphatidylinositol (3,4,5)-trisphosphate-dependent Arf6 GAP that binds RhoA-GTP, but it lacks the predicted catalytic arginine in the RHO-GAP domain and does not have RHO-GAP activity. The protein associates with focal adhesions and functions downstream of RhoA to regulate focal adhesion dynamics. [provided by RefSeq, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 183,765,702 (GRCm39) S119N probably benign Het
Arl10 T C 13: 54,723,621 (GRCm39) probably benign Het
Axin1 A G 17: 26,407,060 (GRCm39) E551G probably damaging Het
Ccr6 T A 17: 8,475,254 (GRCm39) L153Q probably damaging Het
Cntnap2 C T 6: 47,248,164 (GRCm39) P1190L probably damaging Het
Cul7 T A 17: 46,974,116 (GRCm39) L1467H probably damaging Het
Cux1 T A 5: 136,342,144 (GRCm39) D416V probably damaging Het
Cyp2c67 G T 19: 39,631,818 (GRCm39) F126L probably damaging Het
Cyp3a57 A G 5: 145,327,278 (GRCm39) I490V probably benign Het
Dsc1 T C 18: 20,228,098 (GRCm39) probably null Het
Fam83f T A 15: 80,576,285 (GRCm39) V312E probably damaging Het
Fsip2 A G 2: 82,828,375 (GRCm39) D6724G possibly damaging Het
Gabrr3 G T 16: 59,281,887 (GRCm39) C414F probably benign Het
Gm21738 T C 14: 19,415,963 (GRCm38) K192R probably benign Het
H2bc18 T A 3: 96,177,402 (GRCm39) V112E probably benign Het
Herc1 A T 9: 66,347,160 (GRCm39) K2005M possibly damaging Het
Isyna1 C A 8: 71,048,936 (GRCm39) N338K probably damaging Het
Kalrn T C 16: 34,205,760 (GRCm39) D39G probably damaging Het
Mndal T A 1: 173,690,411 (GRCm39) R306S possibly damaging Het
Nek2 A G 1: 191,559,349 (GRCm39) R285G probably benign Het
Nrg2 A G 18: 36,154,144 (GRCm39) I591T probably benign Het
Or8u8 A G 2: 86,012,152 (GRCm39) L101S probably damaging Het
Pcdh10 T C 3: 45,335,236 (GRCm39) S517P probably damaging Het
Pdcd2l G T 7: 33,895,771 (GRCm39) D67E probably benign Het
Pex1 C A 5: 3,683,943 (GRCm39) D1146E probably benign Het
Pid1 A T 1: 84,136,946 (GRCm39) Y62N probably benign Het
Ppp4r1 T C 17: 66,148,013 (GRCm39) *935R probably null Het
Stag1 T C 9: 100,658,877 (GRCm39) F155L probably damaging Het
Stag1 G A 9: 100,812,069 (GRCm39) probably null Het
Taok2 C T 7: 126,474,323 (GRCm39) R302Q possibly damaging Het
Tbc1d8 A G 1: 39,445,882 (GRCm39) V103A probably damaging Het
Terf2ip T A 8: 112,738,349 (GRCm39) I79N probably damaging Het
Tgfb3 G A 12: 86,116,606 (GRCm39) T144I probably damaging Het
Top1 A G 2: 160,559,343 (GRCm39) N622S possibly damaging Het
Trappc9 T A 15: 72,871,823 (GRCm39) Q489L probably damaging Het
Vmn2r69 T C 7: 85,056,108 (GRCm39) T677A probably damaging Het
Wdr35 T C 12: 9,036,104 (GRCm39) F292L probably benign Het
Other mutations in Arap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Arap2 APN 5 62,793,305 (GRCm39) missense probably damaging 1.00
IGL00642:Arap2 APN 5 62,890,401 (GRCm39) nonsense probably null
IGL00705:Arap2 APN 5 62,835,366 (GRCm39) missense probably damaging 1.00
IGL00942:Arap2 APN 5 62,855,732 (GRCm39) nonsense probably null
IGL01069:Arap2 APN 5 62,807,199 (GRCm39) missense probably benign
IGL01601:Arap2 APN 5 62,798,685 (GRCm39) missense probably damaging 1.00
IGL01986:Arap2 APN 5 62,779,265 (GRCm39) missense probably damaging 1.00
IGL02032:Arap2 APN 5 62,828,340 (GRCm39) missense probably damaging 0.99
IGL02262:Arap2 APN 5 62,800,184 (GRCm39) missense probably damaging 1.00
IGL02331:Arap2 APN 5 62,807,025 (GRCm39) splice site probably benign
IGL02527:Arap2 APN 5 62,906,650 (GRCm39) missense probably benign
IGL02803:Arap2 APN 5 62,906,452 (GRCm39) missense probably benign
IGL02864:Arap2 APN 5 62,835,308 (GRCm39) missense probably damaging 1.00
IGL03078:Arap2 APN 5 62,890,408 (GRCm39) splice site probably benign
IGL03154:Arap2 APN 5 62,800,268 (GRCm39) missense probably damaging 1.00
IGL03213:Arap2 APN 5 62,906,438 (GRCm39) missense probably benign 0.00
IGL03279:Arap2 APN 5 62,779,253 (GRCm39) missense probably damaging 1.00
IGL03288:Arap2 APN 5 62,761,959 (GRCm39) missense probably benign 0.00
PIT4354001:Arap2 UTSW 5 62,811,392 (GRCm39) missense probably damaging 1.00
R0012:Arap2 UTSW 5 62,840,827 (GRCm39) missense probably damaging 1.00
R0013:Arap2 UTSW 5 62,840,827 (GRCm39) missense probably damaging 1.00
R0013:Arap2 UTSW 5 62,840,827 (GRCm39) missense probably damaging 1.00
R0166:Arap2 UTSW 5 62,833,361 (GRCm39) missense probably damaging 1.00
R0472:Arap2 UTSW 5 62,864,002 (GRCm39) missense probably damaging 1.00
R0506:Arap2 UTSW 5 62,763,474 (GRCm39) missense possibly damaging 0.87
R0551:Arap2 UTSW 5 62,798,666 (GRCm39) splice site probably null
R0607:Arap2 UTSW 5 62,763,474 (GRCm39) missense possibly damaging 0.87
R0617:Arap2 UTSW 5 62,807,250 (GRCm39) splice site probably benign
R0975:Arap2 UTSW 5 62,888,229 (GRCm39) splice site probably benign
R1164:Arap2 UTSW 5 62,840,820 (GRCm39) missense probably damaging 1.00
R1268:Arap2 UTSW 5 62,887,964 (GRCm39) missense probably benign 0.00
R1480:Arap2 UTSW 5 62,826,472 (GRCm39) nonsense probably null
R1502:Arap2 UTSW 5 62,761,747 (GRCm39) missense probably benign 0.00
R1543:Arap2 UTSW 5 62,763,498 (GRCm39) nonsense probably null
R1865:Arap2 UTSW 5 62,855,606 (GRCm39) missense probably damaging 0.97
R1962:Arap2 UTSW 5 62,834,007 (GRCm39) missense possibly damaging 0.82
R2040:Arap2 UTSW 5 62,906,259 (GRCm39) missense probably damaging 0.99
R2118:Arap2 UTSW 5 62,864,028 (GRCm39) missense probably damaging 1.00
R2131:Arap2 UTSW 5 62,835,301 (GRCm39) missense probably damaging 1.00
R2201:Arap2 UTSW 5 62,864,028 (GRCm39) missense probably damaging 1.00
R2215:Arap2 UTSW 5 62,834,519 (GRCm39) missense probably damaging 1.00
R3027:Arap2 UTSW 5 62,827,240 (GRCm39) missense probably damaging 1.00
R3053:Arap2 UTSW 5 62,906,200 (GRCm39) missense probably benign 0.35
R3975:Arap2 UTSW 5 62,906,237 (GRCm39) missense possibly damaging 0.87
R4272:Arap2 UTSW 5 62,828,322 (GRCm39) missense possibly damaging 0.63
R4273:Arap2 UTSW 5 62,828,322 (GRCm39) missense possibly damaging 0.63
R4326:Arap2 UTSW 5 62,779,206 (GRCm39) missense possibly damaging 0.50
R4327:Arap2 UTSW 5 62,779,206 (GRCm39) missense possibly damaging 0.50
R4328:Arap2 UTSW 5 62,779,206 (GRCm39) missense possibly damaging 0.50
R4451:Arap2 UTSW 5 62,906,513 (GRCm39) missense probably benign 0.06
R4659:Arap2 UTSW 5 62,811,469 (GRCm39) missense possibly damaging 0.94
R4665:Arap2 UTSW 5 62,827,312 (GRCm39) missense possibly damaging 0.95
R4715:Arap2 UTSW 5 62,906,437 (GRCm39) missense probably benign 0.43
R4808:Arap2 UTSW 5 62,887,984 (GRCm39) missense probably benign 0.23
R4941:Arap2 UTSW 5 62,906,821 (GRCm39) missense probably benign 0.20
R4983:Arap2 UTSW 5 62,833,868 (GRCm39) missense probably damaging 0.98
R5095:Arap2 UTSW 5 62,811,392 (GRCm39) missense probably damaging 1.00
R5156:Arap2 UTSW 5 62,826,524 (GRCm39) nonsense probably null
R5201:Arap2 UTSW 5 62,840,832 (GRCm39) missense probably damaging 1.00
R5346:Arap2 UTSW 5 62,872,089 (GRCm39) missense probably benign 0.39
R5359:Arap2 UTSW 5 62,840,762 (GRCm39) nonsense probably null
R5426:Arap2 UTSW 5 62,800,159 (GRCm39) missense probably benign 0.02
R5503:Arap2 UTSW 5 62,787,529 (GRCm39) missense probably damaging 1.00
R5605:Arap2 UTSW 5 62,772,410 (GRCm39) missense possibly damaging 0.47
R5764:Arap2 UTSW 5 62,800,197 (GRCm39) missense probably damaging 1.00
R5813:Arap2 UTSW 5 62,834,506 (GRCm39) missense probably damaging 1.00
R5846:Arap2 UTSW 5 62,807,116 (GRCm39) missense probably damaging 1.00
R6084:Arap2 UTSW 5 62,828,297 (GRCm39) missense possibly damaging 0.89
R6173:Arap2 UTSW 5 62,906,965 (GRCm39) missense probably damaging 1.00
R6175:Arap2 UTSW 5 62,872,074 (GRCm39) critical splice donor site probably null
R6249:Arap2 UTSW 5 62,803,536 (GRCm39) missense probably damaging 0.99
R6386:Arap2 UTSW 5 62,761,865 (GRCm39) missense possibly damaging 0.89
R6424:Arap2 UTSW 5 62,840,707 (GRCm39) missense probably damaging 1.00
R6744:Arap2 UTSW 5 62,906,281 (GRCm39) missense probably damaging 1.00
R6766:Arap2 UTSW 5 62,834,443 (GRCm39) critical splice donor site probably null
R6990:Arap2 UTSW 5 62,833,860 (GRCm39) missense probably damaging 0.96
R7067:Arap2 UTSW 5 62,811,387 (GRCm39) critical splice donor site probably null
R7098:Arap2 UTSW 5 62,833,293 (GRCm39) critical splice donor site probably null
R7107:Arap2 UTSW 5 62,763,551 (GRCm39) missense probably damaging 0.98
R7156:Arap2 UTSW 5 62,761,914 (GRCm39) missense probably damaging 1.00
R7174:Arap2 UTSW 5 62,761,621 (GRCm39) missense probably benign
R7187:Arap2 UTSW 5 62,826,396 (GRCm39) missense probably damaging 0.99
R7197:Arap2 UTSW 5 62,798,729 (GRCm39) missense possibly damaging 0.89
R7214:Arap2 UTSW 5 62,906,681 (GRCm39) missense probably benign 0.00
R7317:Arap2 UTSW 5 62,807,067 (GRCm39) missense probably damaging 1.00
R7392:Arap2 UTSW 5 62,855,728 (GRCm39) missense possibly damaging 0.54
R7438:Arap2 UTSW 5 62,906,818 (GRCm39) missense probably damaging 0.99
R7452:Arap2 UTSW 5 62,833,892 (GRCm39) missense probably benign 0.00
R7495:Arap2 UTSW 5 62,833,893 (GRCm39) missense possibly damaging 0.78
R7796:Arap2 UTSW 5 62,888,105 (GRCm39) missense probably damaging 1.00
R7936:Arap2 UTSW 5 62,888,048 (GRCm39) missense probably damaging 0.96
R8116:Arap2 UTSW 5 62,887,954 (GRCm39) missense probably benign 0.00
R8172:Arap2 UTSW 5 62,779,324 (GRCm39) splice site probably null
R8277:Arap2 UTSW 5 62,771,335 (GRCm39) critical splice donor site probably null
R8369:Arap2 UTSW 5 62,761,669 (GRCm39) nonsense probably null
R8398:Arap2 UTSW 5 62,906,252 (GRCm39) missense probably damaging 1.00
R8893:Arap2 UTSW 5 62,888,037 (GRCm39) missense probably damaging 1.00
R8973:Arap2 UTSW 5 62,855,668 (GRCm39) nonsense probably null
R9102:Arap2 UTSW 5 62,906,341 (GRCm39) missense probably benign 0.03
R9121:Arap2 UTSW 5 62,906,326 (GRCm39) missense possibly damaging 0.84
R9174:Arap2 UTSW 5 62,855,606 (GRCm39) missense probably damaging 1.00
R9222:Arap2 UTSW 5 62,828,421 (GRCm39) missense possibly damaging 0.96
R9281:Arap2 UTSW 5 62,906,848 (GRCm39) missense probably damaging 0.97
R9399:Arap2 UTSW 5 62,763,455 (GRCm39) missense possibly damaging 0.62
R9450:Arap2 UTSW 5 62,855,762 (GRCm39) missense probably benign 0.16
R9467:Arap2 UTSW 5 62,887,900 (GRCm39) missense probably benign 0.00
R9567:Arap2 UTSW 5 62,761,841 (GRCm39) missense probably benign 0.01
R9577:Arap2 UTSW 5 62,769,060 (GRCm39) missense probably damaging 1.00
R9626:Arap2 UTSW 5 62,906,878 (GRCm39) missense probably benign 0.00
R9688:Arap2 UTSW 5 62,872,109 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GAGAGCGTCATCAATGTCCGACAG -3'
(R):5'- GCTCCAAACCCAGGGATAAGACTTC -3'

Sequencing Primer
(F):5'- TGTCCGACAGAAAACTCTTCAG -3'
(R):5'- TTGCGTCCAATTGTAGGAAAGC -3'
Posted On 2013-11-07