Incidental Mutation 'R0885:Mrgprb3'
ID81151
Institutional Source Beutler Lab
Gene Symbol Mrgprb3
Ensembl Gene ENSMUSG00000070546
Gene NameMAS-related GPR, member B3
SynonymsMrgB3
MMRRC Submission 039052-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R0885 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location48642803-48643811 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 48643096 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 236 (G236W)
Ref Sequence ENSEMBL: ENSMUSP00000091945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094383]
Predicted Effect probably damaging
Transcript: ENSMUST00000094383
AA Change: G236W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091945
Gene: ENSMUSG00000070546
AA Change: G236W

DomainStartEndE-ValueType
SCOP:d1l9ha_ 25 279 4e-13 SMART
low complexity region 301 312 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 T C 8: 24,651,786 K256E probably damaging Het
Adam20 T A 8: 40,796,558 H568Q probably benign Het
Ambp A G 4: 63,151,468 L107P probably damaging Het
Art1 T C 7: 102,107,334 F244S probably damaging Het
Asxl2 C A 12: 3,501,458 L1067I probably damaging Het
Atm T C 9: 53,459,823 T2242A probably benign Het
Atp2c1 C T 9: 105,421,573 probably null Het
Bptf A G 11: 107,043,791 Y2819H probably damaging Het
Caskin1 G A 17: 24,505,694 R1152H probably damaging Het
Chd7 T A 4: 8,866,432 L868Q probably damaging Het
Cyp2d40 T C 15: 82,760,915 E178G unknown Het
Dclk1 G T 3: 55,487,307 R103S probably damaging Het
Des A G 1: 75,360,730 T105A probably damaging Het
Ebf3 T C 7: 137,225,884 T262A probably benign Het
Epha4 A G 1: 77,382,939 V759A probably damaging Het
Fam192a C A 8: 94,575,779 C208F probably damaging Het
Fryl A T 5: 73,089,196 F1078I probably damaging Het
Il20 T C 1: 130,910,781 I60V probably benign Het
Kif3c A T 12: 3,365,981 M1L probably benign Het
Lhfpl5 A T 17: 28,576,037 I13F probably damaging Het
Lin28b C T 10: 45,381,228 G218E probably damaging Het
Lrp2 A T 2: 69,482,353 N2530K possibly damaging Het
Matn2 T A 15: 34,316,605 F31Y possibly damaging Het
Mcm6 T C 1: 128,348,933 N307D probably benign Het
Mmp16 A T 4: 18,054,491 R332S probably benign Het
Mpdz T A 4: 81,369,592 T477S probably benign Het
Mrpl47 T C 3: 32,730,186 D145G probably damaging Het
Myo6 T C 9: 80,242,221 S150P probably damaging Het
Naca C A 10: 128,040,179 S360* probably null Het
Olfr319 C T 11: 58,702,087 P129S possibly damaging Het
Phip C A 9: 82,875,395 A1575S probably benign Het
Plxna2 T C 1: 194,644,556 M266T probably benign Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Prag1 T C 8: 36,103,267 F335L probably benign Het
Prmt2 A G 10: 76,222,565 Y137H probably damaging Het
Ptgds T C 2: 25,467,345 D184G possibly damaging Het
Ptpn5 T C 7: 47,088,611 Y241C probably benign Het
Pxdn G A 12: 30,003,402 V1193M probably benign Het
Raet1e T A 10: 22,182,087 probably benign Het
Rttn A G 18: 88,983,810 D282G probably benign Het
Sis G A 3: 72,911,949 R1425* probably null Het
Slco2a1 G T 9: 103,082,383 M559I probably damaging Het
Spata4 C T 8: 54,600,844 A15V probably damaging Het
Spop T C 11: 95,470,627 S14P probably benign Het
Tcof1 A T 18: 60,835,850 D230E possibly damaging Het
Thap8 T A 7: 30,280,669 Y46* probably null Het
Tmem55b T C 14: 50,930,306 E54G probably damaging Het
Tubgcp5 T A 7: 55,806,055 L277* probably null Het
Ubxn10 A T 4: 138,720,570 V265E probably damaging Het
Ugt2b36 T A 5: 87,091,989 Y179F probably benign Het
Wdr37 A C 13: 8,835,252 probably null Het
Zfp593 A G 4: 134,244,913 V94A probably benign Het
Other mutations in Mrgprb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03069:Mrgprb3 APN 7 48643450 missense possibly damaging 0.71
Reserve UTSW 7 48643699 missense probably benign 0.02
starker UTSW 7 48643368 missense probably benign 0.28
IGL03052:Mrgprb3 UTSW 7 48643593 missense possibly damaging 0.93
R0446:Mrgprb3 UTSW 7 48643236 missense probably benign 0.42
R0546:Mrgprb3 UTSW 7 48643515 missense probably damaging 1.00
R1764:Mrgprb3 UTSW 7 48643023 missense probably benign 0.01
R2044:Mrgprb3 UTSW 7 48643734 missense possibly damaging 0.92
R2230:Mrgprb3 UTSW 7 48643022 missense probably benign 0.05
R2232:Mrgprb3 UTSW 7 48643022 missense probably benign 0.05
R2240:Mrgprb3 UTSW 7 48643641 missense probably damaging 0.99
R3001:Mrgprb3 UTSW 7 48643484 missense probably benign
R3002:Mrgprb3 UTSW 7 48643484 missense probably benign
R4717:Mrgprb3 UTSW 7 48643252 missense probably benign 0.01
R4805:Mrgprb3 UTSW 7 48643306 missense probably benign 0.01
R5083:Mrgprb3 UTSW 7 48643014 missense probably benign 0.01
R5311:Mrgprb3 UTSW 7 48643311 missense probably damaging 1.00
R5330:Mrgprb3 UTSW 7 48642934 missense possibly damaging 0.90
R5331:Mrgprb3 UTSW 7 48642934 missense possibly damaging 0.90
R5615:Mrgprb3 UTSW 7 48643486 missense probably benign 0.01
R5621:Mrgprb3 UTSW 7 48643368 missense probably benign 0.28
R5697:Mrgprb3 UTSW 7 48642925 missense probably damaging 0.96
R5725:Mrgprb3 UTSW 7 48643800 start codon destroyed probably null 0.02
R5758:Mrgprb3 UTSW 7 48643319 missense probably benign 0.01
R5807:Mrgprb3 UTSW 7 48643362 missense probably benign 0.02
R5908:Mrgprb3 UTSW 7 48643618 missense probably damaging 0.98
R6902:Mrgprb3 UTSW 7 48643699 missense probably benign 0.02
R7037:Mrgprb3 UTSW 7 48643194 missense probably damaging 1.00
R7288:Mrgprb3 UTSW 7 48643311 missense probably damaging 1.00
R7605:Mrgprb3 UTSW 7 48643114 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCCATGCCTAATGGAGCCAAC -3'
(R):5'- AGCATTGAGTGCTGCCTGTCTATC -3'

Sequencing Primer
(F):5'- CAAGGAAGTATATGGTAGCATTGAC -3'
(R):5'- GGTATCACTGCCAACGTCC -3'
Posted On2013-11-07