Incidental Mutation 'R0885:Tubgcp5'
ID81153
Institutional Source Beutler Lab
Gene Symbol Tubgcp5
Ensembl Gene ENSMUSG00000033790
Gene Nametubulin, gamma complex associated protein 5
SynonymsB130010C12Rik, GCP5
MMRRC Submission 039052-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R0885 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location55794154-55831677 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 55806055 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 277 (L277*)
Ref Sequence ENSEMBL: ENSMUSP00000146111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032627] [ENSMUST00000205796] [ENSMUST00000206191]
Predicted Effect probably null
Transcript: ENSMUST00000032627
AA Change: L277*
SMART Domains Protein: ENSMUSP00000032627
Gene: ENSMUSG00000033790
AA Change: L277*

DomainStartEndE-ValueType
low complexity region 109 124 N/A INTRINSIC
Pfam:Spc97_Spc98 273 942 1.2e-126 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205779
Predicted Effect probably null
Transcript: ENSMUST00000205796
AA Change: L277*
Predicted Effect probably benign
Transcript: ENSMUST00000206191
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206789
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 T C 8: 24,651,786 K256E probably damaging Het
Adam20 T A 8: 40,796,558 H568Q probably benign Het
Ambp A G 4: 63,151,468 L107P probably damaging Het
Art1 T C 7: 102,107,334 F244S probably damaging Het
Asxl2 C A 12: 3,501,458 L1067I probably damaging Het
Atm T C 9: 53,459,823 T2242A probably benign Het
Atp2c1 C T 9: 105,421,573 probably null Het
Bptf A G 11: 107,043,791 Y2819H probably damaging Het
Caskin1 G A 17: 24,505,694 R1152H probably damaging Het
Chd7 T A 4: 8,866,432 L868Q probably damaging Het
Cyp2d40 T C 15: 82,760,915 E178G unknown Het
Dclk1 G T 3: 55,487,307 R103S probably damaging Het
Des A G 1: 75,360,730 T105A probably damaging Het
Ebf3 T C 7: 137,225,884 T262A probably benign Het
Epha4 A G 1: 77,382,939 V759A probably damaging Het
Fam192a C A 8: 94,575,779 C208F probably damaging Het
Fryl A T 5: 73,089,196 F1078I probably damaging Het
Il20 T C 1: 130,910,781 I60V probably benign Het
Kif3c A T 12: 3,365,981 M1L probably benign Het
Lhfpl5 A T 17: 28,576,037 I13F probably damaging Het
Lin28b C T 10: 45,381,228 G218E probably damaging Het
Lrp2 A T 2: 69,482,353 N2530K possibly damaging Het
Matn2 T A 15: 34,316,605 F31Y possibly damaging Het
Mcm6 T C 1: 128,348,933 N307D probably benign Het
Mmp16 A T 4: 18,054,491 R332S probably benign Het
Mpdz T A 4: 81,369,592 T477S probably benign Het
Mrgprb3 C A 7: 48,643,096 G236W probably damaging Het
Mrpl47 T C 3: 32,730,186 D145G probably damaging Het
Myo6 T C 9: 80,242,221 S150P probably damaging Het
Naca C A 10: 128,040,179 S360* probably null Het
Olfr319 C T 11: 58,702,087 P129S possibly damaging Het
Phip C A 9: 82,875,395 A1575S probably benign Het
Plxna2 T C 1: 194,644,556 M266T probably benign Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Prag1 T C 8: 36,103,267 F335L probably benign Het
Prmt2 A G 10: 76,222,565 Y137H probably damaging Het
Ptgds T C 2: 25,467,345 D184G possibly damaging Het
Ptpn5 T C 7: 47,088,611 Y241C probably benign Het
Pxdn G A 12: 30,003,402 V1193M probably benign Het
Raet1e T A 10: 22,182,087 probably benign Het
Rttn A G 18: 88,983,810 D282G probably benign Het
Sis G A 3: 72,911,949 R1425* probably null Het
Slco2a1 G T 9: 103,082,383 M559I probably damaging Het
Spata4 C T 8: 54,600,844 A15V probably damaging Het
Spop T C 11: 95,470,627 S14P probably benign Het
Tcof1 A T 18: 60,835,850 D230E possibly damaging Het
Thap8 T A 7: 30,280,669 Y46* probably null Het
Tmem55b T C 14: 50,930,306 E54G probably damaging Het
Ubxn10 A T 4: 138,720,570 V265E probably damaging Het
Ugt2b36 T A 5: 87,091,989 Y179F probably benign Het
Wdr37 A C 13: 8,835,252 probably null Het
Zfp593 A G 4: 134,244,913 V94A probably benign Het
Other mutations in Tubgcp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Tubgcp5 APN 7 55806595 missense possibly damaging 0.91
IGL01291:Tubgcp5 APN 7 55808529 missense possibly damaging 0.83
IGL01343:Tubgcp5 APN 7 55796031 splice site probably benign
IGL01597:Tubgcp5 APN 7 55806832 splice site probably benign
IGL01688:Tubgcp5 APN 7 55815018 missense possibly damaging 0.92
IGL01843:Tubgcp5 APN 7 55799473 missense probably benign 0.02
IGL01950:Tubgcp5 APN 7 55806088 missense possibly damaging 0.93
IGL01957:Tubgcp5 APN 7 55818757 missense probably damaging 1.00
IGL02902:Tubgcp5 APN 7 55806607 nonsense probably null
IGL03105:Tubgcp5 APN 7 55825581 missense probably damaging 1.00
ANU05:Tubgcp5 UTSW 7 55808529 missense possibly damaging 0.83
R0078:Tubgcp5 UTSW 7 55818895 missense probably damaging 1.00
R0322:Tubgcp5 UTSW 7 55814978 missense probably damaging 0.98
R0362:Tubgcp5 UTSW 7 55800684 missense probably damaging 1.00
R0449:Tubgcp5 UTSW 7 55823567 missense probably benign
R0488:Tubgcp5 UTSW 7 55829338 missense probably damaging 0.96
R0853:Tubgcp5 UTSW 7 55814851 splice site probably benign
R1483:Tubgcp5 UTSW 7 55825707 critical splice donor site probably null
R1746:Tubgcp5 UTSW 7 55808537 missense probably benign 0.05
R1766:Tubgcp5 UTSW 7 55815020 missense probably benign 0.15
R2148:Tubgcp5 UTSW 7 55799511 missense probably damaging 1.00
R2229:Tubgcp5 UTSW 7 55830881 missense probably damaging 1.00
R3766:Tubgcp5 UTSW 7 55830866 missense probably damaging 0.98
R4154:Tubgcp5 UTSW 7 55805329 missense probably benign 0.01
R4838:Tubgcp5 UTSW 7 55794185 unclassified probably benign
R4948:Tubgcp5 UTSW 7 55806123 missense probably benign 0.00
R5110:Tubgcp5 UTSW 7 55808637 missense probably damaging 0.96
R5347:Tubgcp5 UTSW 7 55823685 missense probably damaging 1.00
R5417:Tubgcp5 UTSW 7 55825661 missense possibly damaging 0.90
R5574:Tubgcp5 UTSW 7 55805329 missense probably benign 0.01
R5758:Tubgcp5 UTSW 7 55818895 missense probably damaging 1.00
R5957:Tubgcp5 UTSW 7 55814962 missense probably benign 0.03
R6014:Tubgcp5 UTSW 7 55823609 missense probably benign
R6141:Tubgcp5 UTSW 7 55806778 missense probably benign 0.30
R6289:Tubgcp5 UTSW 7 55795923 missense probably benign 0.05
R6511:Tubgcp5 UTSW 7 55817392 nonsense probably null
R6563:Tubgcp5 UTSW 7 55825661 missense possibly damaging 0.90
R6574:Tubgcp5 UTSW 7 55823583 missense probably benign
R6596:Tubgcp5 UTSW 7 55806634 missense probably benign 0.38
R7016:Tubgcp5 UTSW 7 55794229 missense possibly damaging 0.76
R7038:Tubgcp5 UTSW 7 55805366 missense probably damaging 0.99
R7075:Tubgcp5 UTSW 7 55829407 missense probably benign 0.04
R7083:Tubgcp5 UTSW 7 55800695 nonsense probably null
R7213:Tubgcp5 UTSW 7 55806112 missense probably damaging 0.97
R7284:Tubgcp5 UTSW 7 55823567 missense probably benign
R7600:Tubgcp5 UTSW 7 55808513 missense probably benign
R7813:Tubgcp5 UTSW 7 55800696 missense possibly damaging 0.49
R7948:Tubgcp5 UTSW 7 55794248 missense probably benign 0.01
Z1088:Tubgcp5 UTSW 7 55815101 missense probably benign
Predicted Primers PCR Primer
(F):5'- AATCCTGTGAAGTTTGACACTCTTCCC -3'
(R):5'- TGTTCCAGCACAGATCGTAAACAGC -3'

Sequencing Primer
(F):5'- CCCATTTTCGTGCAATTGACC -3'
(R):5'- GTTCATACACACTACAGAATTACGG -3'
Posted On2013-11-07