Incidental Mutation 'R0976:Cyp3a57'
ID81157
Institutional Source Beutler Lab
Gene Symbol Cyp3a57
Ensembl Gene ENSMUSG00000070419
Gene Namecytochrome P450, family 3, subfamily a, polypeptide 57
SynonymsEG622127
MMRRC Submission 039105-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R0976 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location145345279-145390926 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 145390468 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 490 (I490V)
Ref Sequence ENSEMBL: ENSMUSP00000078251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079268] [ENSMUST00000174696]
Predicted Effect probably benign
Transcript: ENSMUST00000079268
AA Change: I490V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000078251
Gene: ENSMUSG00000070419
AA Change: I490V

DomainStartEndE-ValueType
Pfam:p450 38 493 6.5e-131 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174696
SMART Domains Protein: ENSMUSP00000133600
Gene: ENSMUSG00000070419

DomainStartEndE-ValueType
Pfam:p450 38 147 1.8e-21 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 97.6%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,505 S119N probably benign Het
Arap2 T A 5: 62,649,884 I1147F probably damaging Het
Arl10 T C 13: 54,575,808 probably benign Het
Axin1 A G 17: 26,188,086 E551G probably damaging Het
Ccr6 T A 17: 8,256,422 L153Q probably damaging Het
Cntnap2 C T 6: 47,271,230 P1190L probably damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Cux1 T A 5: 136,313,290 D416V probably damaging Het
Cyp2c67 G T 19: 39,643,374 F126L probably damaging Het
Dsc1 T C 18: 20,095,041 probably null Het
Fam83f T A 15: 80,692,084 V312E probably damaging Het
Fsip2 A G 2: 82,998,031 D6724G possibly damaging Het
Gabrr3 G T 16: 59,461,524 C414F probably benign Het
Gm21738 T C 14: 19,415,963 K192R probably benign Het
Herc1 A T 9: 66,439,878 K2005M possibly damaging Het
Hist2h2bb T A 3: 96,270,086 V112E probably benign Het
Isyna1 C A 8: 70,596,286 N338K probably damaging Het
Kalrn T C 16: 34,385,390 D39G probably damaging Het
Mndal T A 1: 173,862,845 R306S possibly damaging Het
Nek2 A G 1: 191,827,237 R285G probably benign Het
Nrg2 A G 18: 36,021,091 I591T probably benign Het
Olfr52 A G 2: 86,181,808 L101S probably damaging Het
Pcdh10 T C 3: 45,380,801 S517P probably damaging Het
Pdcd2l G T 7: 34,196,346 D67E probably benign Het
Pex1 C A 5: 3,633,943 D1146E probably benign Het
Pid1 A T 1: 84,159,225 Y62N probably benign Het
Ppp4r1 T C 17: 65,841,018 *935R probably null Het
Stag1 T C 9: 100,776,824 F155L probably damaging Het
Stag1 G A 9: 100,930,016 probably null Het
Taok2 C T 7: 126,875,151 R302Q possibly damaging Het
Tbc1d8 A G 1: 39,406,801 V103A probably damaging Het
Terf2ip T A 8: 112,011,717 I79N probably damaging Het
Tgfb3 G A 12: 86,069,832 T144I probably damaging Het
Top1 A G 2: 160,717,423 N622S possibly damaging Het
Trappc9 T A 15: 72,999,974 Q489L probably damaging Het
Vmn2r69 T C 7: 85,406,900 T677A probably damaging Het
Wdr35 T C 12: 8,986,104 F292L probably benign Het
Other mutations in Cyp3a57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Cyp3a57 APN 5 145371024 missense probably damaging 1.00
IGL00656:Cyp3a57 APN 5 145372549 missense possibly damaging 0.55
IGL01368:Cyp3a57 APN 5 145369068 missense probably damaging 0.99
IGL01602:Cyp3a57 APN 5 145387044 missense probably damaging 1.00
IGL01605:Cyp3a57 APN 5 145387044 missense probably damaging 1.00
IGL01924:Cyp3a57 APN 5 145372629 missense probably benign
IGL02191:Cyp3a57 APN 5 145365685 missense probably damaging 1.00
IGL02213:Cyp3a57 APN 5 145381280 missense probably damaging 1.00
IGL02217:Cyp3a57 APN 5 145369143 splice site probably null
R0141:Cyp3a57 UTSW 5 145362102 missense probably benign 0.05
R0720:Cyp3a57 UTSW 5 145390403 splice site probably benign
R0765:Cyp3a57 UTSW 5 145390410 splice site probably benign
R1494:Cyp3a57 UTSW 5 145381267 missense probably damaging 0.97
R1624:Cyp3a57 UTSW 5 145390415 critical splice acceptor site probably null
R1732:Cyp3a57 UTSW 5 145365645 missense probably damaging 1.00
R1791:Cyp3a57 UTSW 5 145371010 missense probably benign 0.06
R1839:Cyp3a57 UTSW 5 145381301 missense probably damaging 1.00
R1858:Cyp3a57 UTSW 5 145381249 missense probably damaging 1.00
R2095:Cyp3a57 UTSW 5 145369134 nonsense probably null
R2305:Cyp3a57 UTSW 5 145381280 missense probably damaging 1.00
R3954:Cyp3a57 UTSW 5 145349325 critical splice acceptor site probably null
R4289:Cyp3a57 UTSW 5 145349397 missense probably damaging 1.00
R4463:Cyp3a57 UTSW 5 145381274 missense probably damaging 1.00
R4579:Cyp3a57 UTSW 5 145374264 missense probably benign 0.00
R4598:Cyp3a57 UTSW 5 145390417 missense probably benign 0.01
R4678:Cyp3a57 UTSW 5 145370728 splice site probably null
R4853:Cyp3a57 UTSW 5 145365679 missense probably damaging 1.00
R4954:Cyp3a57 UTSW 5 145370955 critical splice acceptor site probably null
R4977:Cyp3a57 UTSW 5 145349426 splice site probably null
R5162:Cyp3a57 UTSW 5 145369083 missense probably damaging 1.00
R5226:Cyp3a57 UTSW 5 145365697 missense probably benign 0.04
R5470:Cyp3a57 UTSW 5 145372619 missense probably benign 0.12
R5568:Cyp3a57 UTSW 5 145370646 missense probably benign 0.01
R5652:Cyp3a57 UTSW 5 145349325 critical splice acceptor site probably null
R5872:Cyp3a57 UTSW 5 145371057 nonsense probably null
R6855:Cyp3a57 UTSW 5 145372566 missense probably damaging 0.97
R6861:Cyp3a57 UTSW 5 145370963 missense possibly damaging 0.85
R6893:Cyp3a57 UTSW 5 145386974 nonsense probably null
R7081:Cyp3a57 UTSW 5 145381373 missense probably damaging 1.00
R7305:Cyp3a57 UTSW 5 145370985 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AACAAGCTCAAGAATGATGGCCGAT -3'
(R):5'- TGGTCCCACGAGAATCAGAAGATGA -3'

Sequencing Primer
(F):5'- CTCAAGAATGATGGCCGATATAAATG -3'
(R):5'- GAATCTCCACGTCTAACATTGAGTC -3'
Posted On2013-11-07