Mutagenetix > Incidental Mutation

Incidental Mutation 'R0885:Phip'

81171

Institutional Source

Beutler Lab

Gene Symbol

Phip

Ensembl Gene

ENSMUSG00000032253

Gene Name

pleckstrin homology domain interacting protein

Synonyms

Wdr11, 2810004D21Rik, 4632404O06Rik, Ndrp

MMRRC Submission

039052-MU

Accession Numbers

Genbank: NM_001081216; MGI: 1932404

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0885 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

82866159-82975516 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 82875395 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 1575 (A1575S)

Ref Sequence

ENSEMBL: ENSMUSP00000034787 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034787]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000034787
AA Change: A1575S

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000034787
Gene: ENSMUSG00000032253
AA Change: A1575S

Domain	Start	End	E-Value	Type
WD40	172	211	1.5e-8	SMART
WD40	214	253	4.1e-9	SMART
WD40	256	299	3.5e-7	SMART
WD40	310	349	1.4e-1	SMART
WD40	354	393	6.6e-10	SMART
WD40	408	452	1.4e-2	SMART
WD40	455	495	3.4e-10	SMART
WD40	498	542	6.6e-2	SMART
low complexity region	802	813	N/A	INTRINSIC
low complexity region	841	854	N/A	INTRINSIC
low complexity region	865	877	N/A	INTRINSIC
coiled coil region	881	907	N/A	INTRINSIC
low complexity region	928	941	N/A	INTRINSIC
BROMO	1158	1261	3.5e-11	SMART
BROMO	1318	1423	4.1e-30	SMART
low complexity region	1438	1463	N/A	INTRINSIC
low complexity region	1500	1513	N/A	INTRINSIC
low complexity region	1708	1721	N/A	INTRINSIC
low complexity region	1752	1758	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190774

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 96.9%
20x: 92.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds to the insulin receptor substrate 1 protein and regulates glucose transporter translocation in skeletal muscle cells. The encoded protein may also regulate growth and survival of pancreatic beta cells. Elevated copy number of this gene may be associated with melanoma severity and the encoded protein may promote melanoma metastasis in human patients. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit postnatal and premature lethality associated with reduced body size, small myocardial cells and hepatocytes, hypoglycemia, increased insulin sensitivity, and reduced cell growth. [provided by MGI curators]

Allele List at MGI

All alleles(34) : Gene trapped(34)

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam18	T	C	8: 24,651,786	K256E	probably damaging	Het
Adam20	T	A	8: 40,796,558	H568Q	probably benign	Het
Ambp	A	G	4: 63,151,468	L107P	probably damaging	Het
Art1	T	C	7: 102,107,334	F244S	probably damaging	Het
Asxl2	C	A	12: 3,501,458	L1067I	probably damaging	Het
Atm	T	C	9: 53,459,823	T2242A	probably benign	Het
Atp2c1	C	T	9: 105,421,573		probably null	Het
Bptf	A	G	11: 107,043,791	Y2819H	probably damaging	Het
Caskin1	G	A	17: 24,505,694	R1152H	probably damaging	Het
Chd7	T	A	4: 8,866,432	L868Q	probably damaging	Het
Cyp2d40	T	C	15: 82,760,915	E178G	unknown	Het
Dclk1	G	T	3: 55,487,307	R103S	probably damaging	Het
Des	A	G	1: 75,360,730	T105A	probably damaging	Het
Ebf3	T	C	7: 137,225,884	T262A	probably benign	Het
Epha4	A	G	1: 77,382,939	V759A	probably damaging	Het
Fam192a	C	A	8: 94,575,779	C208F	probably damaging	Het
Fryl	A	T	5: 73,089,196	F1078I	probably damaging	Het
Il20	T	C	1: 130,910,781	I60V	probably benign	Het
Kif3c	A	T	12: 3,365,981	M1L	probably benign	Het
Lhfpl5	A	T	17: 28,576,037	I13F	probably damaging	Het
Lin28b	C	T	10: 45,381,228	G218E	probably damaging	Het
Lrp2	A	T	2: 69,482,353	N2530K	possibly damaging	Het
Matn2	T	A	15: 34,316,605	F31Y	possibly damaging	Het
Mcm6	T	C	1: 128,348,933	N307D	probably benign	Het
Mmp16	A	T	4: 18,054,491	R332S	probably benign	Het
Mpdz	T	A	4: 81,369,592	T477S	probably benign	Het
Mrgprb3	C	A	7: 48,643,096	G236W	probably damaging	Het
Mrpl47	T	C	3: 32,730,186	D145G	probably damaging	Het
Myo6	T	C	9: 80,242,221	S150P	probably damaging	Het
Naca	C	A	10: 128,040,179	S360*	probably null	Het
Olfr319	C	T	11: 58,702,087	P129S	possibly damaging	Het
Plxna2	T	C	1: 194,644,556	M266T	probably benign	Het
Ppp1r16a	C	T	15: 76,693,669	Q328*	probably null	Het
Prag1	T	C	8: 36,103,267	F335L	probably benign	Het
Prmt2	A	G	10: 76,222,565	Y137H	probably damaging	Het
Ptgds	T	C	2: 25,467,345	D184G	possibly damaging	Het
Ptpn5	T	C	7: 47,088,611	Y241C	probably benign	Het
Pxdn	G	A	12: 30,003,402	V1193M	probably benign	Het
Raet1e	T	A	10: 22,182,087		probably benign	Het
Rttn	A	G	18: 88,983,810	D282G	probably benign	Het
Sis	G	A	3: 72,911,949	R1425*	probably null	Het
Slco2a1	G	T	9: 103,082,383	M559I	probably damaging	Het
Spata4	C	T	8: 54,600,844	A15V	probably damaging	Het
Spop	T	C	11: 95,470,627	S14P	probably benign	Het
Tcof1	A	T	18: 60,835,850	D230E	possibly damaging	Het
Thap8	T	A	7: 30,280,669	Y46*	probably null	Het
Tmem55b	T	C	14: 50,930,306	E54G	probably damaging	Het
Tubgcp5	T	A	7: 55,806,055	L277*	probably null	Het
Ubxn10	A	T	4: 138,720,570	V265E	probably damaging	Het
Ugt2b36	T	A	5: 87,091,989	Y179F	probably benign	Het
Wdr37	A	C	13: 8,835,252		probably null	Het
Zfp593	A	G	4: 134,244,913	V94A	probably benign	Het

Other mutations in Phip

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00809:Phip	APN	9	82871303	missense	probably damaging	0.99
IGL01510:Phip	APN	9	82913871	missense	probably benign	0.01
IGL01916:Phip	APN	9	82890469	missense	possibly damaging	0.61
IGL02068:Phip	APN	9	82945808	missense	probably damaging	1.00
IGL02089:Phip	APN	9	82871319	missense	probably damaging	1.00
IGL02121:Phip	APN	9	82893370	missense	probably damaging	1.00
IGL02132:Phip	APN	9	82881341	missense	possibly damaging	0.91
IGL02146:Phip	APN	9	82881718	missense	probably benign	0.05
IGL02282:Phip	APN	9	82913690	missense	probably benign	0.09
IGL02341:Phip	APN	9	82932883	missense	probably damaging	1.00
IGL02342:Phip	APN	9	82886692	missense	probably damaging	1.00
IGL02470:Phip	APN	9	82890454	missense	possibly damaging	0.69
IGL02585:Phip	APN	9	82903188	missense	probably benign	0.03
IGL03271:Phip	APN	9	82884824	splice site	probably benign
3-1:Phip	UTSW	9	82886671	missense	probably damaging	1.00
R0102:Phip	UTSW	9	82905792	splice site	probably null
R0102:Phip	UTSW	9	82905792	splice site	probably null
R0137:Phip	UTSW	9	82927191	splice site	probably null
R0268:Phip	UTSW	9	82871288	missense	probably damaging	1.00
R0366:Phip	UTSW	9	82926407	missense	probably damaging	1.00
R0421:Phip	UTSW	9	82926457	missense	probably damaging	1.00
R0481:Phip	UTSW	9	82876716	splice site	probably benign
R0883:Phip	UTSW	9	82876221	missense	probably benign	0.01
R1300:Phip	UTSW	9	82876747	missense	probably benign	0.00
R1434:Phip	UTSW	9	82959605	missense	probably damaging	0.99
R1448:Phip	UTSW	9	82915423	missense	possibly damaging	0.92
R1588:Phip	UTSW	9	82900828	missense	probably damaging	1.00
R1619:Phip	UTSW	9	82871449	missense	probably benign	0.20
R1658:Phip	UTSW	9	82871498	missense	probably benign
R1688:Phip	UTSW	9	82871657	missense	probably benign
R1773:Phip	UTSW	9	82876189	missense	probably benign
R1865:Phip	UTSW	9	82945792	missense	probably damaging	1.00
R1934:Phip	UTSW	9	82903182	missense	probably benign	0.11
R2070:Phip	UTSW	9	82875299	missense	probably benign
R2096:Phip	UTSW	9	82915339	missense	possibly damaging	0.95
R2097:Phip	UTSW	9	82915339	missense	possibly damaging	0.95
R2099:Phip	UTSW	9	82915339	missense	possibly damaging	0.95
R2192:Phip	UTSW	9	82871815	missense	probably damaging	0.99
R2402:Phip	UTSW	9	82875305	missense	probably benign
R2447:Phip	UTSW	9	82915399	missense	probably damaging	0.99
R2504:Phip	UTSW	9	82915339	missense	possibly damaging	0.95
R2507:Phip	UTSW	9	82915339	missense	possibly damaging	0.95
R2508:Phip	UTSW	9	82915339	missense	possibly damaging	0.95
R3706:Phip	UTSW	9	82900743	missense	probably benign	0.02
R3829:Phip	UTSW	9	82871645	missense	probably benign
R3846:Phip	UTSW	9	82876126	nonsense	probably null
R4301:Phip	UTSW	9	82959713	nonsense	probably null
R4366:Phip	UTSW	9	82900869	intron	probably benign
R4748:Phip	UTSW	9	82908869	missense	probably benign	0.01
R4895:Phip	UTSW	9	82959595	missense	probably benign	0.20
R5001:Phip	UTSW	9	82896019	splice site	probably null
R5094:Phip	UTSW	9	82871844	missense	probably benign
R5181:Phip	UTSW	9	82871190	utr 3 prime	probably benign
R5194:Phip	UTSW	9	82908862	missense	probably benign	0.03
R5291:Phip	UTSW	9	82945883	missense	probably damaging	1.00
R5335:Phip	UTSW	9	82900756	missense	possibly damaging	0.93
R5458:Phip	UTSW	9	82926500	missense	probably benign	0.40
R5704:Phip	UTSW	9	82871355	missense	probably damaging	0.97
R5866:Phip	UTSW	9	82890150	missense	probably benign
R5870:Phip	UTSW	9	82908677	splice site	probably benign
R5890:Phip	UTSW	9	82906952	missense	probably benign	0.00
R6232:Phip	UTSW	9	82903181	missense	probably benign
R6379:Phip	UTSW	9	82913857	missense	probably damaging	0.98
R6653:Phip	UTSW	9	82900741	nonsense	probably null
R7129:Phip	UTSW	9	82877300	missense	probably damaging	0.98
R7290:Phip	UTSW	9	82871293	missense	possibly damaging	0.94
R7598:Phip	UTSW	9	82905658	missense	possibly damaging	0.94
R7632:Phip	UTSW	9	82903190	missense	probably benign
R7752:Phip	UTSW	9	82890150	missense	probably benign
R7827:Phip	UTSW	9	82908833	missense	probably benign
R7901:Phip	UTSW	9	82890150	missense	probably benign
R7960:Phip	UTSW	9	82893348	missense	probably benign	0.00
R8006:Phip	UTSW	9	82890126	missense	possibly damaging	0.93
R8066:Phip	UTSW	9	82875298	missense	probably benign	0.05
R8080:Phip	UTSW	9	82887609	missense	probably damaging	1.00
R8135:Phip	UTSW	9	82930374	missense	probably benign	0.09
R8347:Phip	UTSW	9	82908763	missense	probably benign	0.02
R8459:Phip	UTSW	9	82876053	missense	probably benign
R8705:Phip	UTSW	9	82893559	missense	probably damaging	0.99
R8706:Phip	UTSW	9	82905712	missense	possibly damaging	0.89
R8743:Phip	UTSW	9	82927087	missense	probably benign	0.18
R8801:Phip	UTSW	9	82876252	missense	probably benign	0.22
R8930:Phip	UTSW	9	82906988	missense	possibly damaging	0.67
R8932:Phip	UTSW	9	82906988	missense	possibly damaging	0.67
R8969:Phip	UTSW	9	82926964	intron	probably benign
R9064:Phip	UTSW	9	82871487	missense	probably benign	0.20
R9332:Phip	UTSW	9	82875359	missense	probably damaging	0.98
R9335:Phip	UTSW	9	82932926	missense	probably benign	0.03
R9520:Phip	UTSW	9	82871384	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- GGCCAGCGCATTCAAGCATTAC -3'
(R):5'- TGCAGTCCAGCACTGTAGAAGGAG -3'

Sequencing Primer
(F):5'- ATTACAGAGGCTTGGCCTTAGAC -3'
(R):5'- AAGCTTTAAGTATCTCTCACTCGG -3'

Posted On

2013-11-07