Incidental Mutation 'R0885:Raet1e'
Institutional Source Beutler Lab
Gene Symbol Raet1e
Ensembl Gene ENSMUSG00000053219
Gene Nameretinoic acid early transcript 1E
SynonymsRae-1 epsilon
MMRRC Submission 039052-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.689) question?
Stock #R0885 (G1)
Quality Score225
Status Not validated
Chromosomal Location22158569-22374139 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 22182087 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065527] [ENSMUST00000105522] [ENSMUST00000178026] [ENSMUST00000180648] [ENSMUST00000181645]
Predicted Effect unknown
Transcript: ENSMUST00000065527
AA Change: M251K
SMART Domains Protein: ENSMUSP00000066627
Gene: ENSMUSG00000053219
AA Change: M251K

signal peptide 1 28 N/A INTRINSIC
Pfam:MHC_I_2 31 202 1e-121 PFAM
low complexity region 209 229 N/A INTRINSIC
transmembrane domain 233 250 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105522
SMART Domains Protein: ENSMUSP00000101161
Gene: ENSMUSG00000075297

signal peptide 1 24 N/A INTRINSIC
PDB:4G59|B 29 195 2e-9 PDB
transmembrane domain 211 233 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000178026
AA Change: M251K
SMART Domains Protein: ENSMUSP00000136032
Gene: ENSMUSG00000053219
AA Change: M251K

signal peptide 1 28 N/A INTRINSIC
Pfam:MHC_I_2 31 202 7.3e-112 PFAM
low complexity region 209 229 N/A INTRINSIC
transmembrane domain 233 250 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180456
Predicted Effect probably benign
Transcript: ENSMUST00000180648
SMART Domains Protein: ENSMUSP00000137946
Gene: ENSMUSG00000053219

signal peptide 1 28 N/A INTRINSIC
Pfam:MHC_I_2 31 66 3.8e-20 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000181645
AA Change: M251K
SMART Domains Protein: ENSMUSP00000138022
Gene: ENSMUSG00000053219
AA Change: M251K

signal peptide 1 28 N/A INTRINSIC
Pfam:MHC_I_2 31 202 1e-121 PFAM
low complexity region 209 229 N/A INTRINSIC
transmembrane domain 233 250 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 T C 8: 24,651,786 K256E probably damaging Het
Adam20 T A 8: 40,796,558 H568Q probably benign Het
Ambp A G 4: 63,151,468 L107P probably damaging Het
Art1 T C 7: 102,107,334 F244S probably damaging Het
Asxl2 C A 12: 3,501,458 L1067I probably damaging Het
Atm T C 9: 53,459,823 T2242A probably benign Het
Atp2c1 C T 9: 105,421,573 probably null Het
Bptf A G 11: 107,043,791 Y2819H probably damaging Het
Caskin1 G A 17: 24,505,694 R1152H probably damaging Het
Chd7 T A 4: 8,866,432 L868Q probably damaging Het
Cyp2d40 T C 15: 82,760,915 E178G unknown Het
Dclk1 G T 3: 55,487,307 R103S probably damaging Het
Des A G 1: 75,360,730 T105A probably damaging Het
Ebf3 T C 7: 137,225,884 T262A probably benign Het
Epha4 A G 1: 77,382,939 V759A probably damaging Het
Fam192a C A 8: 94,575,779 C208F probably damaging Het
Fryl A T 5: 73,089,196 F1078I probably damaging Het
Il20 T C 1: 130,910,781 I60V probably benign Het
Kif3c A T 12: 3,365,981 M1L probably benign Het
Lhfpl5 A T 17: 28,576,037 I13F probably damaging Het
Lin28b C T 10: 45,381,228 G218E probably damaging Het
Lrp2 A T 2: 69,482,353 N2530K possibly damaging Het
Matn2 T A 15: 34,316,605 F31Y possibly damaging Het
Mcm6 T C 1: 128,348,933 N307D probably benign Het
Mmp16 A T 4: 18,054,491 R332S probably benign Het
Mpdz T A 4: 81,369,592 T477S probably benign Het
Mrgprb3 C A 7: 48,643,096 G236W probably damaging Het
Mrpl47 T C 3: 32,730,186 D145G probably damaging Het
Myo6 T C 9: 80,242,221 S150P probably damaging Het
Naca C A 10: 128,040,179 S360* probably null Het
Olfr319 C T 11: 58,702,087 P129S possibly damaging Het
Phip C A 9: 82,875,395 A1575S probably benign Het
Plxna2 T C 1: 194,644,556 M266T probably benign Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Prag1 T C 8: 36,103,267 F335L probably benign Het
Prmt2 A G 10: 76,222,565 Y137H probably damaging Het
Ptgds T C 2: 25,467,345 D184G possibly damaging Het
Ptpn5 T C 7: 47,088,611 Y241C probably benign Het
Pxdn G A 12: 30,003,402 V1193M probably benign Het
Rttn A G 18: 88,983,810 D282G probably benign Het
Sis G A 3: 72,911,949 R1425* probably null Het
Slco2a1 G T 9: 103,082,383 M559I probably damaging Het
Spata4 C T 8: 54,600,844 A15V probably damaging Het
Spop T C 11: 95,470,627 S14P probably benign Het
Tcof1 A T 18: 60,835,850 D230E possibly damaging Het
Thap8 T A 7: 30,280,669 Y46* probably null Het
Tmem55b T C 14: 50,930,306 E54G probably damaging Het
Tubgcp5 T A 7: 55,806,055 L277* probably null Het
Ubxn10 A T 4: 138,720,570 V265E probably damaging Het
Ugt2b36 T A 5: 87,091,989 Y179F probably benign Het
Wdr37 A C 13: 8,835,252 probably null Het
Zfp593 A G 4: 134,244,913 V94A probably benign Het
Other mutations in Raet1e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01077:Raet1e APN 10 22181320 missense probably damaging 1.00
IGL02406:Raet1e APN 10 22180636 missense probably damaging 1.00
IGL02484:Raet1e APN 10 22180767 missense probably benign 0.01
R0049:Raet1e UTSW 10 22180862 missense possibly damaging 0.65
R0238:Raet1e UTSW 10 22180862 missense possibly damaging 0.65
R0238:Raet1e UTSW 10 22180862 missense possibly damaging 0.65
R0239:Raet1e UTSW 10 22180862 missense possibly damaging 0.65
R0639:Raet1e UTSW 10 22174375 missense probably damaging 0.99
R3704:Raet1e UTSW 10 22180845 missense probably benign 0.20
R4764:Raet1e UTSW 10 22181332 missense probably damaging 1.00
R4799:Raet1e UTSW 10 22181300 missense probably damaging 1.00
R5566:Raet1e UTSW 10 22174405 missense probably damaging 1.00
R6034:Raet1e UTSW 10 22182091 makesense probably null
R6034:Raet1e UTSW 10 22182091 makesense probably null
R6077:Raet1e UTSW 10 22181988 missense possibly damaging 0.72
R6238:Raet1e UTSW 10 22180871 missense probably benign 0.01
R6408:Raet1e UTSW 10 22180746 missense probably benign 0.29
R6939:Raet1e UTSW 10 22174357 missense possibly damaging 0.86
R7147:Raet1e UTSW 10 22181280 missense probably benign 0.29
R8026:Raet1e UTSW 10 22181299 missense probably damaging 1.00
Z1088:Raet1e UTSW 10 22181951 missense possibly damaging 0.56
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gcttgtttcagccacttcttatg -3'
Posted On2013-11-07