Incidental Mutation 'R0885:Lin28b'
ID81179
Institutional Source Beutler Lab
Gene Symbol Lin28b
Ensembl Gene ENSMUSG00000063804
Gene Namelin-28 homolog B (C. elegans)
Synonyms
MMRRC Submission 039052-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R0885 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location45376620-45486395 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 45381228 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 218 (G218E)
Ref Sequence ENSEMBL: ENSMUSP00000078361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079390]
Predicted Effect probably damaging
Transcript: ENSMUST00000079390
AA Change: G218E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000078361
Gene: ENSMUSG00000063804
AA Change: G218E

DomainStartEndE-ValueType
CSP 29 100 3.98e-14 SMART
ZnF_C2HC 150 166 2.77e-2 SMART
ZnF_C2HC 172 188 1.79e-1 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the lin-28 family, which is characterized by the presence of a cold-shock domain and a pair of CCHC zinc finger domains. This gene is highly expressed in testis, fetal liver, placenta, and in primary human tumors and cancer cell lines. It is negatively regulated by microRNAs that target sites in the 3' UTR, and overexpression of this gene in primary tumors is linked to the repression of let-7 family of microRNAs and derepression of let-7 targets, which facilitates cellular transformation. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal dwarfism in male, but not female, mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 T C 8: 24,651,786 K256E probably damaging Het
Adam20 T A 8: 40,796,558 H568Q probably benign Het
Ambp A G 4: 63,151,468 L107P probably damaging Het
Art1 T C 7: 102,107,334 F244S probably damaging Het
Asxl2 C A 12: 3,501,458 L1067I probably damaging Het
Atm T C 9: 53,459,823 T2242A probably benign Het
Atp2c1 C T 9: 105,421,573 probably null Het
Bptf A G 11: 107,043,791 Y2819H probably damaging Het
Caskin1 G A 17: 24,505,694 R1152H probably damaging Het
Chd7 T A 4: 8,866,432 L868Q probably damaging Het
Cyp2d40 T C 15: 82,760,915 E178G unknown Het
Dclk1 G T 3: 55,487,307 R103S probably damaging Het
Des A G 1: 75,360,730 T105A probably damaging Het
Ebf3 T C 7: 137,225,884 T262A probably benign Het
Epha4 A G 1: 77,382,939 V759A probably damaging Het
Fam192a C A 8: 94,575,779 C208F probably damaging Het
Fryl A T 5: 73,089,196 F1078I probably damaging Het
Il20 T C 1: 130,910,781 I60V probably benign Het
Kif3c A T 12: 3,365,981 M1L probably benign Het
Lhfpl5 A T 17: 28,576,037 I13F probably damaging Het
Lrp2 A T 2: 69,482,353 N2530K possibly damaging Het
Matn2 T A 15: 34,316,605 F31Y possibly damaging Het
Mcm6 T C 1: 128,348,933 N307D probably benign Het
Mmp16 A T 4: 18,054,491 R332S probably benign Het
Mpdz T A 4: 81,369,592 T477S probably benign Het
Mrgprb3 C A 7: 48,643,096 G236W probably damaging Het
Mrpl47 T C 3: 32,730,186 D145G probably damaging Het
Myo6 T C 9: 80,242,221 S150P probably damaging Het
Naca C A 10: 128,040,179 S360* probably null Het
Olfr319 C T 11: 58,702,087 P129S possibly damaging Het
Phip C A 9: 82,875,395 A1575S probably benign Het
Plxna2 T C 1: 194,644,556 M266T probably benign Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Prag1 T C 8: 36,103,267 F335L probably benign Het
Prmt2 A G 10: 76,222,565 Y137H probably damaging Het
Ptgds T C 2: 25,467,345 D184G possibly damaging Het
Ptpn5 T C 7: 47,088,611 Y241C probably benign Het
Pxdn G A 12: 30,003,402 V1193M probably benign Het
Raet1e T A 10: 22,182,087 probably benign Het
Rttn A G 18: 88,983,810 D282G probably benign Het
Sis G A 3: 72,911,949 R1425* probably null Het
Slco2a1 G T 9: 103,082,383 M559I probably damaging Het
Spata4 C T 8: 54,600,844 A15V probably damaging Het
Spop T C 11: 95,470,627 S14P probably benign Het
Tcof1 A T 18: 60,835,850 D230E possibly damaging Het
Thap8 T A 7: 30,280,669 Y46* probably null Het
Tmem55b T C 14: 50,930,306 E54G probably damaging Het
Tubgcp5 T A 7: 55,806,055 L277* probably null Het
Ubxn10 A T 4: 138,720,570 V265E probably damaging Het
Ugt2b36 T A 5: 87,091,989 Y179F probably benign Het
Wdr37 A C 13: 8,835,252 probably null Het
Zfp593 A G 4: 134,244,913 V94A probably benign Het
Other mutations in Lin28b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02598:Lin28b APN 10 45420526 missense possibly damaging 0.57
IGL02819:Lin28b APN 10 45470059 start codon destroyed probably null 0.10
R2407:Lin28b UTSW 10 45381087 missense possibly damaging 0.95
R4962:Lin28b UTSW 10 45420640 missense possibly damaging 0.90
R5523:Lin28b UTSW 10 45469068 nonsense probably null
R7122:Lin28b UTSW 10 45469148 missense probably benign 0.18
R7293:Lin28b UTSW 10 45419186 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGTGCTTGCATGAGGTAGACTTCC -3'
(R):5'- TGCTACAACTGTGGTGGTCTCGAC -3'

Sequencing Primer
(F):5'- TGAGGTAGACTTCCCGCCC -3'
(R):5'- TGGTCTCGACCATCATGCTAAAG -3'
Posted On2013-11-07