Incidental Mutation 'R0885:Olfr319'
ID81187
Institutional Source Beutler Lab
Gene Symbol Olfr319
Ensembl Gene ENSMUSG00000064044
Gene Nameolfactory receptor 319
SynonymsMOR285-2, GA_x6K02T2NKPP-708319-707399
MMRRC Submission 039052-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R0885 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location58699162-58703472 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 58702087 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 129 (P129S)
Ref Sequence ENSEMBL: ENSMUSP00000150883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076965] [ENSMUST00000215962]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076965
AA Change: P129S

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000076232
Gene: ENSMUSG00000064044
AA Change: P129S

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 3.8e-46 PFAM
Pfam:7tm_1 41 290 1.4e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215238
Predicted Effect possibly damaging
Transcript: ENSMUST00000215962
AA Change: P129S

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 T C 8: 24,651,786 K256E probably damaging Het
Adam20 T A 8: 40,796,558 H568Q probably benign Het
Ambp A G 4: 63,151,468 L107P probably damaging Het
Art1 T C 7: 102,107,334 F244S probably damaging Het
Asxl2 C A 12: 3,501,458 L1067I probably damaging Het
Atm T C 9: 53,459,823 T2242A probably benign Het
Atp2c1 C T 9: 105,421,573 probably null Het
Bptf A G 11: 107,043,791 Y2819H probably damaging Het
Caskin1 G A 17: 24,505,694 R1152H probably damaging Het
Chd7 T A 4: 8,866,432 L868Q probably damaging Het
Cyp2d40 T C 15: 82,760,915 E178G unknown Het
Dclk1 G T 3: 55,487,307 R103S probably damaging Het
Des A G 1: 75,360,730 T105A probably damaging Het
Ebf3 T C 7: 137,225,884 T262A probably benign Het
Epha4 A G 1: 77,382,939 V759A probably damaging Het
Fam192a C A 8: 94,575,779 C208F probably damaging Het
Fryl A T 5: 73,089,196 F1078I probably damaging Het
Il20 T C 1: 130,910,781 I60V probably benign Het
Kif3c A T 12: 3,365,981 M1L probably benign Het
Lhfpl5 A T 17: 28,576,037 I13F probably damaging Het
Lin28b C T 10: 45,381,228 G218E probably damaging Het
Lrp2 A T 2: 69,482,353 N2530K possibly damaging Het
Matn2 T A 15: 34,316,605 F31Y possibly damaging Het
Mcm6 T C 1: 128,348,933 N307D probably benign Het
Mmp16 A T 4: 18,054,491 R332S probably benign Het
Mpdz T A 4: 81,369,592 T477S probably benign Het
Mrgprb3 C A 7: 48,643,096 G236W probably damaging Het
Mrpl47 T C 3: 32,730,186 D145G probably damaging Het
Myo6 T C 9: 80,242,221 S150P probably damaging Het
Naca C A 10: 128,040,179 S360* probably null Het
Phip C A 9: 82,875,395 A1575S probably benign Het
Plxna2 T C 1: 194,644,556 M266T probably benign Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Prag1 T C 8: 36,103,267 F335L probably benign Het
Prmt2 A G 10: 76,222,565 Y137H probably damaging Het
Ptgds T C 2: 25,467,345 D184G possibly damaging Het
Ptpn5 T C 7: 47,088,611 Y241C probably benign Het
Pxdn G A 12: 30,003,402 V1193M probably benign Het
Raet1e T A 10: 22,182,087 probably benign Het
Rttn A G 18: 88,983,810 D282G probably benign Het
Sis G A 3: 72,911,949 R1425* probably null Het
Slco2a1 G T 9: 103,082,383 M559I probably damaging Het
Spata4 C T 8: 54,600,844 A15V probably damaging Het
Spop T C 11: 95,470,627 S14P probably benign Het
Tcof1 A T 18: 60,835,850 D230E possibly damaging Het
Thap8 T A 7: 30,280,669 Y46* probably null Het
Tmem55b T C 14: 50,930,306 E54G probably damaging Het
Tubgcp5 T A 7: 55,806,055 L277* probably null Het
Ubxn10 A T 4: 138,720,570 V265E probably damaging Het
Ugt2b36 T A 5: 87,091,989 Y179F probably benign Het
Wdr37 A C 13: 8,835,252 probably null Het
Zfp593 A G 4: 134,244,913 V94A probably benign Het
Other mutations in Olfr319
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01398:Olfr319 APN 11 58701767 missense probably benign
IGL01955:Olfr319 APN 11 58702129 missense probably damaging 0.97
IGL02145:Olfr319 APN 11 58702060 missense probably damaging 0.99
IGL02283:Olfr319 APN 11 58702276 missense probably damaging 0.96
R0468:Olfr319 UTSW 11 58701793 missense probably damaging 1.00
R0499:Olfr319 UTSW 11 58702243 missense probably benign 0.01
R0815:Olfr319 UTSW 11 58702609 missense possibly damaging 0.84
R1081:Olfr319 UTSW 11 58702498 missense probably damaging 1.00
R1603:Olfr319 UTSW 11 58702460 missense probably benign 0.00
R1935:Olfr319 UTSW 11 58702346 missense probably damaging 1.00
R1936:Olfr319 UTSW 11 58702346 missense probably damaging 1.00
R1938:Olfr319 UTSW 11 58702623 makesense probably null
R2436:Olfr319 UTSW 11 58702126 missense probably damaging 0.97
R4243:Olfr319 UTSW 11 58702451 missense probably damaging 1.00
R4244:Olfr319 UTSW 11 58702451 missense probably damaging 1.00
R4742:Olfr319 UTSW 11 58701859 missense probably benign
R4801:Olfr319 UTSW 11 58701791 missense probably benign
R4802:Olfr319 UTSW 11 58701791 missense probably benign
R4927:Olfr319 UTSW 11 58701807 missense probably damaging 1.00
R5259:Olfr319 UTSW 11 58701952 missense probably benign 0.07
R5259:Olfr319 UTSW 11 58701953 missense possibly damaging 0.83
R5393:Olfr319 UTSW 11 58702500 missense probably damaging 0.97
R5471:Olfr319 UTSW 11 58702325 missense probably damaging 0.98
R5571:Olfr319 UTSW 11 58702051 missense probably damaging 1.00
R6746:Olfr319 UTSW 11 58702543 missense probably benign
R7045:Olfr319 UTSW 11 58701669 start gained probably benign
X0065:Olfr319 UTSW 11 58702489 missense probably benign 0.02
Z1177:Olfr319 UTSW 11 58702113 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCAGGCTGGATAGAAGACTCCACAC -3'
(R):5'- CTGCCCTGAACCCATCTGGAATAC -3'

Sequencing Primer
(F):5'- GCTCTCCATCATTGACATGATGTG -3'
(R):5'- GTGTCTTCACACACAAGTGGC -3'
Posted On2013-11-07