Incidental Mutation 'R0885:Pxdn'
ID81196
Institutional Source Beutler Lab
Gene Symbol Pxdn
Ensembl Gene ENSMUSG00000020674
Gene Nameperoxidasin
SynonymsVPO1, 2310075M15Rik
MMRRC Submission 039052-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.600) question?
Stock #R0885 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location29937608-30017658 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 30003402 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 1193 (V1193M)
Ref Sequence ENSEMBL: ENSMUSP00000113703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122328] [ENSMUST00000220271]
Predicted Effect probably benign
Transcript: ENSMUST00000122328
AA Change: V1193M

PolyPhen 2 Score 0.302 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113703
Gene: ENSMUSG00000020674
AA Change: V1193M

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LRRNT 32 63 2.52e-1 SMART
LRR 62 81 4.09e1 SMART
LRR_TYP 82 105 3.69e-4 SMART
LRR_TYP 106 129 1.45e-2 SMART
LRR_TYP 130 153 8.02e-5 SMART
LRR_TYP 154 177 1.06e-4 SMART
LRRCT 189 241 3.97e-5 SMART
IGc2 255 321 1.59e-15 SMART
IGc2 351 416 3.96e-16 SMART
IGc2 442 506 2.96e-15 SMART
IGc2 534 598 1.2e-15 SMART
Pfam:An_peroxidase 738 1286 1.1e-196 PFAM
VWC 1411 1466 8.8e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126233
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137316
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155190
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218620
Predicted Effect probably benign
Transcript: ENSMUST00000220271
AA Change: V1013M

PolyPhen 2 Score 0.257 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heme-containing peroxidase that is secreted into the extracellular matrix. It is involved in extracellular matrix formation, and may function in the physiological and pathological fibrogenic response in fibrotic kidney. Mutations in this gene cause corneal opacification and other ocular anomalies, and also microphthalmia and anterior segment dysgenesis. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit abnormal eye development with early-onset glaucoma and progressive retinal dysgenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 T C 8: 24,651,786 K256E probably damaging Het
Adam20 T A 8: 40,796,558 H568Q probably benign Het
Ambp A G 4: 63,151,468 L107P probably damaging Het
Art1 T C 7: 102,107,334 F244S probably damaging Het
Asxl2 C A 12: 3,501,458 L1067I probably damaging Het
Atm T C 9: 53,459,823 T2242A probably benign Het
Atp2c1 C T 9: 105,421,573 probably null Het
Bptf A G 11: 107,043,791 Y2819H probably damaging Het
Caskin1 G A 17: 24,505,694 R1152H probably damaging Het
Chd7 T A 4: 8,866,432 L868Q probably damaging Het
Cyp2d40 T C 15: 82,760,915 E178G unknown Het
Dclk1 G T 3: 55,487,307 R103S probably damaging Het
Des A G 1: 75,360,730 T105A probably damaging Het
Ebf3 T C 7: 137,225,884 T262A probably benign Het
Epha4 A G 1: 77,382,939 V759A probably damaging Het
Fam192a C A 8: 94,575,779 C208F probably damaging Het
Fryl A T 5: 73,089,196 F1078I probably damaging Het
Il20 T C 1: 130,910,781 I60V probably benign Het
Kif3c A T 12: 3,365,981 M1L probably benign Het
Lhfpl5 A T 17: 28,576,037 I13F probably damaging Het
Lin28b C T 10: 45,381,228 G218E probably damaging Het
Lrp2 A T 2: 69,482,353 N2530K possibly damaging Het
Matn2 T A 15: 34,316,605 F31Y possibly damaging Het
Mcm6 T C 1: 128,348,933 N307D probably benign Het
Mmp16 A T 4: 18,054,491 R332S probably benign Het
Mpdz T A 4: 81,369,592 T477S probably benign Het
Mrgprb3 C A 7: 48,643,096 G236W probably damaging Het
Mrpl47 T C 3: 32,730,186 D145G probably damaging Het
Myo6 T C 9: 80,242,221 S150P probably damaging Het
Naca C A 10: 128,040,179 S360* probably null Het
Olfr319 C T 11: 58,702,087 P129S possibly damaging Het
Phip C A 9: 82,875,395 A1575S probably benign Het
Plxna2 T C 1: 194,644,556 M266T probably benign Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Prag1 T C 8: 36,103,267 F335L probably benign Het
Prmt2 A G 10: 76,222,565 Y137H probably damaging Het
Ptgds T C 2: 25,467,345 D184G possibly damaging Het
Ptpn5 T C 7: 47,088,611 Y241C probably benign Het
Raet1e T A 10: 22,182,087 probably benign Het
Rttn A G 18: 88,983,810 D282G probably benign Het
Sis G A 3: 72,911,949 R1425* probably null Het
Slco2a1 G T 9: 103,082,383 M559I probably damaging Het
Spata4 C T 8: 54,600,844 A15V probably damaging Het
Spop T C 11: 95,470,627 S14P probably benign Het
Tcof1 A T 18: 60,835,850 D230E possibly damaging Het
Thap8 T A 7: 30,280,669 Y46* probably null Het
Tmem55b T C 14: 50,930,306 E54G probably damaging Het
Tubgcp5 T A 7: 55,806,055 L277* probably null Het
Ubxn10 A T 4: 138,720,570 V265E probably damaging Het
Ugt2b36 T A 5: 87,091,989 Y179F probably benign Het
Wdr37 A C 13: 8,835,252 probably null Het
Zfp593 A G 4: 134,244,913 V94A probably benign Het
Other mutations in Pxdn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Pxdn APN 12 29987099 missense probably damaging 1.00
IGL01152:Pxdn APN 12 30001937 missense probably damaging 0.99
IGL01286:Pxdn APN 12 29982754 missense probably benign 0.04
IGL01323:Pxdn APN 12 29987137 missense probably benign 0.00
IGL01338:Pxdn APN 12 30002797 missense probably damaging 1.00
IGL01341:Pxdn APN 12 30002487 missense probably damaging 1.00
IGL01401:Pxdn APN 12 30001984 missense probably damaging 1.00
IGL01580:Pxdn APN 12 29984493 missense probably benign 0.18
IGL01650:Pxdn APN 12 30002401 missense probably benign 0.01
IGL01679:Pxdn APN 12 29999902 missense probably damaging 0.97
IGL01866:Pxdn APN 12 29984571 missense probably benign 0.02
IGL02354:Pxdn APN 12 29999189 missense probably damaging 1.00
IGL02361:Pxdn APN 12 29999189 missense probably damaging 1.00
IGL02427:Pxdn APN 12 29984532 missense probably damaging 1.00
IGL02955:Pxdn APN 12 30003157 missense probably damaging 1.00
IGL03079:Pxdn APN 12 30002998 missense probably damaging 0.97
IGL03111:Pxdn APN 12 29982756 missense probably damaging 0.99
IGL02988:Pxdn UTSW 12 30003114 nonsense probably null
PIT4280001:Pxdn UTSW 12 29995328 missense probably damaging 0.99
PIT4469001:Pxdn UTSW 12 30005829 missense probably benign 0.00
R0070:Pxdn UTSW 12 29982727 missense probably damaging 0.99
R0070:Pxdn UTSW 12 29982727 missense probably damaging 0.99
R0086:Pxdn UTSW 12 30002419 missense possibly damaging 0.95
R0140:Pxdn UTSW 12 29982754 missense probably benign 0.04
R0201:Pxdn UTSW 12 30002431 missense possibly damaging 0.79
R0282:Pxdn UTSW 12 29984440 nonsense probably null
R0310:Pxdn UTSW 12 30015529 missense probably damaging 1.00
R0426:Pxdn UTSW 12 29987066 missense possibly damaging 0.89
R0468:Pxdn UTSW 12 29994486 missense probably damaging 0.99
R0825:Pxdn UTSW 12 29984996 splice site probably benign
R1420:Pxdn UTSW 12 30002068 missense probably damaging 1.00
R1588:Pxdn UTSW 12 30002559 missense probably damaging 1.00
R2269:Pxdn UTSW 12 30005775 missense probably damaging 0.97
R2280:Pxdn UTSW 12 29984906 missense probably damaging 0.98
R2504:Pxdn UTSW 12 30003406 missense probably damaging 1.00
R2679:Pxdn UTSW 12 29975569 splice site probably benign
R3116:Pxdn UTSW 12 30002307 missense possibly damaging 0.89
R3607:Pxdn UTSW 12 29990918 missense probably benign 0.04
R4033:Pxdn UTSW 12 30003225 missense probably benign 0.19
R4576:Pxdn UTSW 12 30011923 missense probably benign
R4659:Pxdn UTSW 12 29994553 missense probably benign 0.01
R4681:Pxdn UTSW 12 30012326 missense probably benign 0.45
R4968:Pxdn UTSW 12 30000012 missense probably benign 0.25
R5032:Pxdn UTSW 12 30003141 missense probably benign 0.08
R5232:Pxdn UTSW 12 29990988 missense probably benign 0.08
R5366:Pxdn UTSW 12 30002900 missense probably damaging 1.00
R5504:Pxdn UTSW 12 30002801 missense probably damaging 1.00
R5586:Pxdn UTSW 12 30003142 missense probably damaging 0.99
R5739:Pxdn UTSW 12 29982334 missense probably benign 0.03
R5877:Pxdn UTSW 12 30003046 missense probably damaging 1.00
R6167:Pxdn UTSW 12 29974001 missense probably damaging 1.00
R6191:Pxdn UTSW 12 29982717 missense possibly damaging 0.94
R6200:Pxdn UTSW 12 30003112 missense probably damaging 1.00
R6609:Pxdn UTSW 12 30002941 missense probably benign 0.00
R6628:Pxdn UTSW 12 29999918 missense probably damaging 1.00
R6865:Pxdn UTSW 12 30014583 splice site probably null
R6921:Pxdn UTSW 12 30015505 missense probably damaging 0.96
R6995:Pxdn UTSW 12 29995371 missense possibly damaging 0.95
R7211:Pxdn UTSW 12 29984904 missense possibly damaging 0.77
R7220:Pxdn UTSW 12 29994480 missense probably benign 0.02
R7347:Pxdn UTSW 12 30012261 missense probably benign 0.01
R7402:Pxdn UTSW 12 30002439 missense probably damaging 1.00
R7408:Pxdn UTSW 12 29990945 missense probably benign 0.29
R7413:Pxdn UTSW 12 30002928 missense probably benign 0.00
R7447:Pxdn UTSW 12 29984927 missense probably damaging 1.00
R7572:Pxdn UTSW 12 30006705 missense probably damaging 1.00
R7708:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R7815:Pxdn UTSW 12 30005825 missense probably damaging 0.96
R7972:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R8097:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R8098:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R8205:Pxdn UTSW 12 30006567 missense probably damaging 1.00
R8262:Pxdn UTSW 12 29999196 nonsense probably null
R8335:Pxdn UTSW 12 30002097 missense probably damaging 0.99
R8356:Pxdn UTSW 12 30011890 missense probably damaging 0.99
R8437:Pxdn UTSW 12 30002044 missense probably damaging 1.00
R8456:Pxdn UTSW 12 30011890 missense probably damaging 0.99
R8709:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R8772:Pxdn UTSW 12 30015464 missense probably damaging 1.00
Z1177:Pxdn UTSW 12 29990852 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGCATTCCCTCTCAATTGCTGAAC -3'
(R):5'- TGAGGCCCATTTGCCATGTGAC -3'

Sequencing Primer
(F):5'- TCTCAATTGCTGAACACAGAGC -3'
(R):5'- CTGTCCCAGCTAGGAAAGTATAACTG -3'
Posted On2013-11-07