Incidental Mutation 'R0976:Dsc1'
ID81207
Institutional Source Beutler Lab
Gene Symbol Dsc1
Ensembl Gene ENSMUSG00000044322
Gene Namedesmocollin 1
SynonymsDsc1a, Dsc1b
MMRRC Submission 039105-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R0976 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location20084184-20114871 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 20095041 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038710] [ENSMUST00000224432]
Predicted Effect probably null
Transcript: ENSMUST00000038710
SMART Domains Protein: ENSMUSP00000042303
Gene: ENSMUSG00000044322

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
Cadherin_pro 29 111 2.61e-41 SMART
CA 155 240 2.78e-9 SMART
CA 264 352 5.94e-27 SMART
CA 375 470 5.27e-10 SMART
CA 493 575 1.18e-21 SMART
Blast:CA 593 672 5e-46 BLAST
transmembrane domain 692 714 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000224432
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224557
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 97.6%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that mediates adhesion in desmosomes. The encoded preproprotein undergoes proteolytic processing to generate the mature, functional protein. Mice lacking the encoded protein exhibit epidermal fragility together with defects of epidermal barrier and differentiation. The neonatal mice lacking the encoded protein exhibit epidermal lesions and older mice develop chronic dermatitis. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mutants with targeted disruptions of this gene have fragile epidermis, flaky skin, and defects in the epidermal barrier, leading to chronic dermatitis and display abnormal epidermal differentiation as indicated by hyperproliferation and overxpression of keratin 6 and 16. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,505 S119N probably benign Het
Arap2 T A 5: 62,649,884 I1147F probably damaging Het
Arl10 T C 13: 54,575,808 probably benign Het
Axin1 A G 17: 26,188,086 E551G probably damaging Het
Ccr6 T A 17: 8,256,422 L153Q probably damaging Het
Cntnap2 C T 6: 47,271,230 P1190L probably damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Cux1 T A 5: 136,313,290 D416V probably damaging Het
Cyp2c67 G T 19: 39,643,374 F126L probably damaging Het
Cyp3a57 A G 5: 145,390,468 I490V probably benign Het
Fam83f T A 15: 80,692,084 V312E probably damaging Het
Fsip2 A G 2: 82,998,031 D6724G possibly damaging Het
Gabrr3 G T 16: 59,461,524 C414F probably benign Het
Gm21738 T C 14: 19,415,963 K192R probably benign Het
Herc1 A T 9: 66,439,878 K2005M possibly damaging Het
Hist2h2bb T A 3: 96,270,086 V112E probably benign Het
Isyna1 C A 8: 70,596,286 N338K probably damaging Het
Kalrn T C 16: 34,385,390 D39G probably damaging Het
Mndal T A 1: 173,862,845 R306S possibly damaging Het
Nek2 A G 1: 191,827,237 R285G probably benign Het
Nrg2 A G 18: 36,021,091 I591T probably benign Het
Olfr52 A G 2: 86,181,808 L101S probably damaging Het
Pcdh10 T C 3: 45,380,801 S517P probably damaging Het
Pdcd2l G T 7: 34,196,346 D67E probably benign Het
Pex1 C A 5: 3,633,943 D1146E probably benign Het
Pid1 A T 1: 84,159,225 Y62N probably benign Het
Ppp4r1 T C 17: 65,841,018 *935R probably null Het
Stag1 T C 9: 100,776,824 F155L probably damaging Het
Stag1 G A 9: 100,930,016 probably null Het
Taok2 C T 7: 126,875,151 R302Q possibly damaging Het
Tbc1d8 A G 1: 39,406,801 V103A probably damaging Het
Terf2ip T A 8: 112,011,717 I79N probably damaging Het
Tgfb3 G A 12: 86,069,832 T144I probably damaging Het
Top1 A G 2: 160,717,423 N622S possibly damaging Het
Trappc9 T A 15: 72,999,974 Q489L probably damaging Het
Vmn2r69 T C 7: 85,406,900 T677A probably damaging Het
Wdr35 T C 12: 8,986,104 F292L probably benign Het
Other mutations in Dsc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Dsc1 APN 18 20101886 missense probably damaging 1.00
IGL00571:Dsc1 APN 18 20110138 missense probably damaging 1.00
IGL00790:Dsc1 APN 18 20094896 missense probably damaging 1.00
IGL00963:Dsc1 APN 18 20111986 missense probably null 0.01
IGL00972:Dsc1 APN 18 20088363 missense probably benign 0.32
IGL01112:Dsc1 APN 18 20094622 missense probably benign 0.02
IGL01458:Dsc1 APN 18 20099138 missense probably damaging 1.00
IGL01607:Dsc1 APN 18 20089663 missense probably damaging 1.00
IGL01794:Dsc1 APN 18 20110183 missense probably damaging 1.00
IGL01959:Dsc1 APN 18 20097225 missense probably damaging 1.00
IGL02066:Dsc1 APN 18 20108803 unclassified probably benign
IGL02365:Dsc1 APN 18 20108816 missense probably damaging 1.00
IGL02714:Dsc1 APN 18 20087485 missense probably damaging 1.00
IGL02959:Dsc1 APN 18 20108885 missense probably damaging 1.00
IGL03019:Dsc1 APN 18 20088364 missense probably benign 0.00
IGL03106:Dsc1 APN 18 20086644 splice site probably null
R0414:Dsc1 UTSW 18 20088354 missense possibly damaging 0.85
R0456:Dsc1 UTSW 18 20099112 missense probably damaging 1.00
R0612:Dsc1 UTSW 18 20114516 missense probably damaging 0.96
R0630:Dsc1 UTSW 18 20085862 missense probably damaging 1.00
R0646:Dsc1 UTSW 18 20096057 missense probably damaging 1.00
R0928:Dsc1 UTSW 18 20110249 splice site probably null
R1221:Dsc1 UTSW 18 20114542 nonsense probably null
R1398:Dsc1 UTSW 18 20088336 missense probably damaging 1.00
R1902:Dsc1 UTSW 18 20095988 missense probably damaging 1.00
R1903:Dsc1 UTSW 18 20095988 missense probably damaging 1.00
R2070:Dsc1 UTSW 18 20088296 splice site probably null
R2119:Dsc1 UTSW 18 20110152 missense probably benign 0.07
R3935:Dsc1 UTSW 18 20097241 missense probably benign 0.00
R4747:Dsc1 UTSW 18 20094558 missense probably damaging 1.00
R5034:Dsc1 UTSW 18 20095027 missense possibly damaging 0.91
R5243:Dsc1 UTSW 18 20099159 missense probably damaging 1.00
R5289:Dsc1 UTSW 18 20101853 missense possibly damaging 0.72
R5300:Dsc1 UTSW 18 20094860 missense probably damaging 1.00
R5354:Dsc1 UTSW 18 20087575 missense probably damaging 1.00
R5376:Dsc1 UTSW 18 20088446 missense probably benign 0.21
R5808:Dsc1 UTSW 18 20086829 nonsense probably null
R5860:Dsc1 UTSW 18 20095024 missense probably damaging 1.00
R6059:Dsc1 UTSW 18 20110242 missense probably damaging 0.98
R6116:Dsc1 UTSW 18 20097299 missense probably benign 0.10
R6351:Dsc1 UTSW 18 20086769 missense probably damaging 1.00
R6422:Dsc1 UTSW 18 20095033 missense probably damaging 1.00
R6811:Dsc1 UTSW 18 20089654 missense probably benign
R6880:Dsc1 UTSW 18 20088372 missense probably damaging 0.99
R6941:Dsc1 UTSW 18 20097189 missense probably benign 0.00
R6997:Dsc1 UTSW 18 20086644 splice site probably null
R7255:Dsc1 UTSW 18 20097273 missense probably benign 0.12
R7456:Dsc1 UTSW 18 20086822 missense probably benign 0.00
R7492:Dsc1 UTSW 18 20107680 missense possibly damaging 0.46
R7503:Dsc1 UTSW 18 20085865 missense probably damaging 1.00
R8030:Dsc1 UTSW 18 20089571 missense not run
Z1176:Dsc1 UTSW 18 20114538 missense not run
Predicted Primers PCR Primer
(F):5'- ATGACTTTGACTGGTGGCTGGCAC -3'
(R):5'- TCCCCAGGAGCAATTCAAAGCATTC -3'

Sequencing Primer
(F):5'- GGTGGCTGGCACTCAGG -3'
(R):5'- GAGCCTTACTGGGATTAGACAC -3'
Posted On2013-11-07