Mutagenetix > Incidental Mutations

Incidental Mutation 'R0976:Dsc1'

81207

Institutional Source

Beutler Lab

Gene Symbol

Dsc1

Ensembl Gene

ENSMUSG00000044322

Gene Name

desmocollin 1

Synonyms

Dsc1a, Dsc1b

MMRRC Submission

039105-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.089) question?

Stock #

R0976 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

20084184-20114871 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 20095041 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000153639 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038710] [ENSMUST00000224432]

Predicted Effect

probably null
Transcript: ENSMUST00000038710

SMART Domains

Protein: ENSMUSP00000042303
Gene: ENSMUSG00000044322

Domain	Start	End	E-Value	Type
low complexity region	16	26	N/A	INTRINSIC
Cadherin_pro	29	111	2.61e-41	SMART
CA	155	240	2.78e-9	SMART
CA	264	352	5.94e-27	SMART
CA	375	470	5.27e-10	SMART
CA	493	575	1.18e-21	SMART
Blast:CA	593	672	5e-46	BLAST
transmembrane domain	692	714	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000224432

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224557

Coding Region Coverage

1x: 99.8%
3x: 99.3%
10x: 97.6%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of proteins that mediates adhesion in desmosomes. The encoded preproprotein undergoes proteolytic processing to generate the mature, functional protein. Mice lacking the encoded protein exhibit epidermal fragility together with defects of epidermal barrier and differentiation. The neonatal mice lacking the encoded protein exhibit epidermal lesions and older mice develop chronic dermatitis. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mutants with targeted disruptions of this gene have fragile epidermis, flaky skin, and defects in the epidermal barrier, leading to chronic dermatitis and display abnormal epidermal differentiation as indicated by hyperproliferation and overxpression of keratin 6 and 16. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700056E22Rik	C	T	1: 184,033,505	S119N	probably benign	Het
Arap2	T	A	5: 62,649,884	I1147F	probably damaging	Het
Arl10	T	C	13: 54,575,808		probably benign	Het
Axin1	A	G	17: 26,188,086	E551G	probably damaging	Het
Ccr6	T	A	17: 8,256,422	L153Q	probably damaging	Het
Cntnap2	C	T	6: 47,271,230	P1190L	probably damaging	Het
Cul7	T	A	17: 46,663,190	L1467H	probably damaging	Het
Cux1	T	A	5: 136,313,290	D416V	probably damaging	Het
Cyp2c67	G	T	19: 39,643,374	F126L	probably damaging	Het
Cyp3a57	A	G	5: 145,390,468	I490V	probably benign	Het
Fam83f	T	A	15: 80,692,084	V312E	probably damaging	Het
Fsip2	A	G	2: 82,998,031	D6724G	possibly damaging	Het
Gabrr3	G	T	16: 59,461,524	C414F	probably benign	Het
Gm21738	T	C	14: 19,415,963	K192R	probably benign	Het
Herc1	A	T	9: 66,439,878	K2005M	possibly damaging	Het
Hist2h2bb	T	A	3: 96,270,086	V112E	probably benign	Het
Isyna1	C	A	8: 70,596,286	N338K	probably damaging	Het
Kalrn	T	C	16: 34,385,390	D39G	probably damaging	Het
Mndal	T	A	1: 173,862,845	R306S	possibly damaging	Het
Nek2	A	G	1: 191,827,237	R285G	probably benign	Het
Nrg2	A	G	18: 36,021,091	I591T	probably benign	Het
Olfr52	A	G	2: 86,181,808	L101S	probably damaging	Het
Pcdh10	T	C	3: 45,380,801	S517P	probably damaging	Het
Pdcd2l	G	T	7: 34,196,346	D67E	probably benign	Het
Pex1	C	A	5: 3,633,943	D1146E	probably benign	Het
Pid1	A	T	1: 84,159,225	Y62N	probably benign	Het
Ppp4r1	T	C	17: 65,841,018	*935R	probably null	Het
Stag1	T	C	9: 100,776,824	F155L	probably damaging	Het
Stag1	G	A	9: 100,930,016		probably null	Het
Taok2	C	T	7: 126,875,151	R302Q	possibly damaging	Het
Tbc1d8	A	G	1: 39,406,801	V103A	probably damaging	Het
Terf2ip	T	A	8: 112,011,717	I79N	probably damaging	Het
Tgfb3	G	A	12: 86,069,832	T144I	probably damaging	Het
Top1	A	G	2: 160,717,423	N622S	possibly damaging	Het
Trappc9	T	A	15: 72,999,974	Q489L	probably damaging	Het
Vmn2r69	T	C	7: 85,406,900	T677A	probably damaging	Het
Wdr35	T	C	12: 8,986,104	F292L	probably benign	Het

Other mutations in Dsc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Dsc1	APN	18	20101886	missense	probably damaging	1.00
IGL00571:Dsc1	APN	18	20110138	missense	probably damaging	1.00
IGL00790:Dsc1	APN	18	20094896	missense	probably damaging	1.00
IGL00963:Dsc1	APN	18	20111986	missense	probably null	0.01
IGL00972:Dsc1	APN	18	20088363	missense	probably benign	0.32
IGL01112:Dsc1	APN	18	20094622	missense	probably benign	0.02
IGL01458:Dsc1	APN	18	20099138	missense	probably damaging	1.00
IGL01607:Dsc1	APN	18	20089663	missense	probably damaging	1.00
IGL01794:Dsc1	APN	18	20110183	missense	probably damaging	1.00
IGL01959:Dsc1	APN	18	20097225	missense	probably damaging	1.00
IGL02066:Dsc1	APN	18	20108803	unclassified	probably benign
IGL02365:Dsc1	APN	18	20108816	missense	probably damaging	1.00
IGL02714:Dsc1	APN	18	20087485	missense	probably damaging	1.00
IGL02959:Dsc1	APN	18	20108885	missense	probably damaging	1.00
IGL03019:Dsc1	APN	18	20088364	missense	probably benign	0.00
IGL03106:Dsc1	APN	18	20086644	splice site	probably null
R0414:Dsc1	UTSW	18	20088354	missense	possibly damaging	0.85
R0456:Dsc1	UTSW	18	20099112	missense	probably damaging	1.00
R0612:Dsc1	UTSW	18	20114516	missense	probably damaging	0.96
R0630:Dsc1	UTSW	18	20085862	missense	probably damaging	1.00
R0646:Dsc1	UTSW	18	20096057	missense	probably damaging	1.00
R0928:Dsc1	UTSW	18	20110249	splice site	probably null
R1221:Dsc1	UTSW	18	20114542	nonsense	probably null
R1398:Dsc1	UTSW	18	20088336	missense	probably damaging	1.00
R1902:Dsc1	UTSW	18	20095988	missense	probably damaging	1.00
R1903:Dsc1	UTSW	18	20095988	missense	probably damaging	1.00
R2070:Dsc1	UTSW	18	20088296	splice site	probably null
R2119:Dsc1	UTSW	18	20110152	missense	probably benign	0.07
R3935:Dsc1	UTSW	18	20097241	missense	probably benign	0.00
R4747:Dsc1	UTSW	18	20094558	missense	probably damaging	1.00
R5034:Dsc1	UTSW	18	20095027	missense	possibly damaging	0.91
R5243:Dsc1	UTSW	18	20099159	missense	probably damaging	1.00
R5289:Dsc1	UTSW	18	20101853	missense	possibly damaging	0.72
R5300:Dsc1	UTSW	18	20094860	missense	probably damaging	1.00
R5354:Dsc1	UTSW	18	20087575	missense	probably damaging	1.00
R5376:Dsc1	UTSW	18	20088446	missense	probably benign	0.21
R5808:Dsc1	UTSW	18	20086829	nonsense	probably null
R5860:Dsc1	UTSW	18	20095024	missense	probably damaging	1.00
R6059:Dsc1	UTSW	18	20110242	missense	probably damaging	0.98
R6116:Dsc1	UTSW	18	20097299	missense	probably benign	0.10
R6351:Dsc1	UTSW	18	20086769	missense	probably damaging	1.00
R6422:Dsc1	UTSW	18	20095033	missense	probably damaging	1.00
R6811:Dsc1	UTSW	18	20089654	missense	probably benign
R6880:Dsc1	UTSW	18	20088372	missense	probably damaging	0.99
R6941:Dsc1	UTSW	18	20097189	missense	probably benign	0.00
R6997:Dsc1	UTSW	18	20086644	splice site	probably null
R7255:Dsc1	UTSW	18	20097273	missense	probably benign	0.12
R7456:Dsc1	UTSW	18	20086822	missense	probably benign	0.00
R7492:Dsc1	UTSW	18	20107680	missense	possibly damaging	0.46
R7503:Dsc1	UTSW	18	20085865	missense	probably damaging	1.00
R8030:Dsc1	UTSW	18	20089571	missense	not run
Z1176:Dsc1	UTSW	18	20114538	missense	not run

Predicted Primers

PCR Primer
(F):5'- ATGACTTTGACTGGTGGCTGGCAC -3'
(R):5'- TCCCCAGGAGCAATTCAAAGCATTC -3'

Sequencing Primer
(F):5'- GGTGGCTGGCACTCAGG -3'
(R):5'- GAGCCTTACTGGGATTAGACAC -3'

Posted On

2013-11-07