Incidental Mutation 'R0885:Lhfpl5'
ID81218
Institutional Source Beutler Lab
Gene Symbol Lhfpl5
Ensembl Gene ENSMUSG00000062252
Gene Namelipoma HMGIC fusion partner-like 5
SynonymsTmhs, 9330179O15Rik
MMRRC Submission 039052-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R0885 (G1)
Quality Score220
Status Not validated
Chromosome17
Chromosomal Location28575718-28583593 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28576037 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 13 (I13F)
Ref Sequence ENSEMBL: ENSMUSP00000079598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080780]
Predicted Effect probably damaging
Transcript: ENSMUST00000080780
AA Change: I13F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000079598
Gene: ENSMUSG00000062252
AA Change: I13F

DomainStartEndE-ValueType
Pfam:L_HGMIC_fpl 25 202 1.5e-67 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the lipoma HMGIC fusion partner (LHFP) gene family, which is a subset of the superfamily of tetraspan transmembrane protein encoding genes. Mutations in this gene result in deafness in humans, and a mutation in a similar gene in mice results in deafness and vestibular dysfunction with severe degeneration of the organ of Corti. It is proposed to function in hair bundle morphogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in deafness and vestibular dysfunction with severe degeneration of the organ of Corti. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 T C 8: 24,651,786 K256E probably damaging Het
Adam20 T A 8: 40,796,558 H568Q probably benign Het
Ambp A G 4: 63,151,468 L107P probably damaging Het
Art1 T C 7: 102,107,334 F244S probably damaging Het
Asxl2 C A 12: 3,501,458 L1067I probably damaging Het
Atm T C 9: 53,459,823 T2242A probably benign Het
Atp2c1 C T 9: 105,421,573 probably null Het
Bptf A G 11: 107,043,791 Y2819H probably damaging Het
Caskin1 G A 17: 24,505,694 R1152H probably damaging Het
Chd7 T A 4: 8,866,432 L868Q probably damaging Het
Cyp2d40 T C 15: 82,760,915 E178G unknown Het
Dclk1 G T 3: 55,487,307 R103S probably damaging Het
Des A G 1: 75,360,730 T105A probably damaging Het
Ebf3 T C 7: 137,225,884 T262A probably benign Het
Epha4 A G 1: 77,382,939 V759A probably damaging Het
Fam192a C A 8: 94,575,779 C208F probably damaging Het
Fryl A T 5: 73,089,196 F1078I probably damaging Het
Il20 T C 1: 130,910,781 I60V probably benign Het
Kif3c A T 12: 3,365,981 M1L probably benign Het
Lin28b C T 10: 45,381,228 G218E probably damaging Het
Lrp2 A T 2: 69,482,353 N2530K possibly damaging Het
Matn2 T A 15: 34,316,605 F31Y possibly damaging Het
Mcm6 T C 1: 128,348,933 N307D probably benign Het
Mmp16 A T 4: 18,054,491 R332S probably benign Het
Mpdz T A 4: 81,369,592 T477S probably benign Het
Mrgprb3 C A 7: 48,643,096 G236W probably damaging Het
Mrpl47 T C 3: 32,730,186 D145G probably damaging Het
Myo6 T C 9: 80,242,221 S150P probably damaging Het
Naca C A 10: 128,040,179 S360* probably null Het
Olfr319 C T 11: 58,702,087 P129S possibly damaging Het
Phip C A 9: 82,875,395 A1575S probably benign Het
Plxna2 T C 1: 194,644,556 M266T probably benign Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Prag1 T C 8: 36,103,267 F335L probably benign Het
Prmt2 A G 10: 76,222,565 Y137H probably damaging Het
Ptgds T C 2: 25,467,345 D184G possibly damaging Het
Ptpn5 T C 7: 47,088,611 Y241C probably benign Het
Pxdn G A 12: 30,003,402 V1193M probably benign Het
Raet1e T A 10: 22,182,087 probably benign Het
Rttn A G 18: 88,983,810 D282G probably benign Het
Sis G A 3: 72,911,949 R1425* probably null Het
Slco2a1 G T 9: 103,082,383 M559I probably damaging Het
Spata4 C T 8: 54,600,844 A15V probably damaging Het
Spop T C 11: 95,470,627 S14P probably benign Het
Tcof1 A T 18: 60,835,850 D230E possibly damaging Het
Thap8 T A 7: 30,280,669 Y46* probably null Het
Tmem55b T C 14: 50,930,306 E54G probably damaging Het
Tubgcp5 T A 7: 55,806,055 L277* probably null Het
Ubxn10 A T 4: 138,720,570 V265E probably damaging Het
Ugt2b36 T A 5: 87,091,989 Y179F probably benign Het
Wdr37 A C 13: 8,835,252 probably null Het
Zfp593 A G 4: 134,244,913 V94A probably benign Het
Other mutations in Lhfpl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02114:Lhfpl5 APN 17 28576175 missense possibly damaging 0.49
R3176:Lhfpl5 UTSW 17 28579946 missense possibly damaging 0.87
R3276:Lhfpl5 UTSW 17 28579946 missense possibly damaging 0.87
R4747:Lhfpl5 UTSW 17 28579976 missense probably damaging 1.00
R4817:Lhfpl5 UTSW 17 28576326 missense possibly damaging 0.93
R4817:Lhfpl5 UTSW 17 28582988 makesense probably null
R5148:Lhfpl5 UTSW 17 28579968 missense probably damaging 1.00
R5447:Lhfpl5 UTSW 17 28576097 missense probably damaging 1.00
R7024:Lhfpl5 UTSW 17 28582983 missense probably benign 0.15
R7605:Lhfpl5 UTSW 17 28576331 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GGGCACATTCATCTGGGAAGCATC -3'
(R):5'- TTGCCCACGCAGTAGGAGAACAAG -3'

Sequencing Primer
(F):5'- CATCTCTTGCGAAGACAAGGTTG -3'
(R):5'- GCCAAAGTAACCAGCCTGTG -3'
Posted On2013-11-07