Incidental Mutation 'R0938:Ifi204'
ID81221
Institutional Source Beutler Lab
Gene Symbol Ifi204
Ensembl Gene ENSMUSG00000073489
Gene Nameinterferon activated gene 204
Synonymsp204
MMRRC Submission 039077-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R0938 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location173747293-173766943 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 173751745 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 511 (N511K)
Ref Sequence ENSEMBL: ENSMUSP00000106845 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111214]
Predicted Effect possibly damaging
Transcript: ENSMUST00000111214
AA Change: N511K

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106845
Gene: ENSMUSG00000073489
AA Change: N511K

DomainStartEndE-ValueType
PYRIN 6 84 8.33e-14 SMART
low complexity region 120 154 N/A INTRINSIC
low complexity region 190 206 N/A INTRINSIC
Pfam:HIN 225 393 6.2e-78 PFAM
Pfam:HIN 429 595 9.8e-78 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 95.7%
  • 20x: 88.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI413582 T C 17: 27,564,394 K43R possibly damaging Het
Bcan A G 3: 87,993,154 S591P possibly damaging Het
Chfr T C 5: 110,164,058 L579P probably damaging Het
Dab2 C T 15: 6,435,384 T439I probably benign Het
Dazap1 T C 10: 80,280,961 S165P possibly damaging Het
Dlx2 C A 2: 71,544,668 W284L possibly damaging Het
Dync2h1 A T 9: 7,002,658 N3803K probably benign Het
Dynlrb2 A C 8: 116,514,968 probably null Het
Fhl2 A G 1: 43,141,706 I108T possibly damaging Het
Fntb A G 12: 76,916,440 Y399C probably damaging Het
Galnt18 T C 7: 111,519,999 I438M possibly damaging Het
Gnmt A G 17: 46,726,345 L171P probably damaging Het
Gpc1 G A 1: 92,857,309 R358H possibly damaging Het
Klhl1 A T 14: 96,152,040 Y559* probably null Het
Mob1b T A 5: 88,749,593 I120N probably damaging Het
Mybpc2 T C 7: 44,506,887 K834R probably benign Het
Oosp2 G A 19: 11,651,540 Q66* probably null Het
P4ha2 A G 11: 54,119,322 K302E possibly damaging Het
Pard6g C T 18: 80,080,044 R98* probably null Het
Pkdrej G A 15: 85,818,163 P1191S probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ubap2 A C 4: 41,202,304 L708R probably damaging Het
Zfp638 G A 6: 83,984,041 V1204I probably benign Het
Zfp865 G T 7: 5,031,404 C796F possibly damaging Het
Zmiz2 A T 11: 6,397,185 M237L probably benign Het
Other mutations in Ifi204
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Ifi204 APN 1 173759631 splice site probably benign
IGL01922:Ifi204 APN 1 173761722 missense possibly damaging 0.51
IGL02296:Ifi204 APN 1 173749314 missense possibly damaging 0.93
IGL02419:Ifi204 APN 1 173749380 missense possibly damaging 0.71
IGL02505:Ifi204 APN 1 173755654 missense probably benign 0.04
R1363:Ifi204 UTSW 1 173749296 missense probably benign 0.00
R1834:Ifi204 UTSW 1 173747606 missense unknown
R2031:Ifi204 UTSW 1 173752777 missense probably damaging 1.00
R2254:Ifi204 UTSW 1 173761730 missense possibly damaging 0.95
R2379:Ifi204 UTSW 1 173755993 nonsense probably null
R2408:Ifi204 UTSW 1 173755632 missense possibly damaging 0.80
R3011:Ifi204 UTSW 1 173751651 missense probably benign 0.01
R3617:Ifi204 UTSW 1 173755717 missense possibly damaging 0.51
R3894:Ifi204 UTSW 1 173749208 missense possibly damaging 0.86
R3916:Ifi204 UTSW 1 173755775 missense possibly damaging 0.95
R4656:Ifi204 UTSW 1 173760361 intron probably benign
R4657:Ifi204 UTSW 1 173760361 intron probably benign
R4694:Ifi204 UTSW 1 173749259 missense probably damaging 0.99
R4703:Ifi204 UTSW 1 173760361 intron probably benign
R4704:Ifi204 UTSW 1 173760361 intron probably benign
R4894:Ifi204 UTSW 1 173760242 missense probably damaging 0.98
R4947:Ifi204 UTSW 1 173755750 missense probably damaging 0.98
R5023:Ifi204 UTSW 1 173751740 missense possibly damaging 0.93
R5036:Ifi204 UTSW 1 173752745 missense possibly damaging 0.79
R5119:Ifi204 UTSW 1 173755668 missense probably damaging 1.00
R5194:Ifi204 UTSW 1 173749344 missense possibly damaging 0.86
R5762:Ifi204 UTSW 1 173752759 missense probably damaging 0.98
R6063:Ifi204 UTSW 1 173751657 missense probably benign 0.03
R6808:Ifi204 UTSW 1 173761703 missense probably benign 0.27
R7311:Ifi204 UTSW 1 173759568 missense probably benign 0.26
R7338:Ifi204 UTSW 1 173760137 missense possibly damaging 0.67
R7430:Ifi204 UTSW 1 173755681 missense probably benign 0.43
R7528:Ifi204 UTSW 1 173751840 missense probably benign 0.06
Z1176:Ifi204 UTSW 1 173751628 missense probably null 0.00
Predicted Primers PCR Primer
(F):5'- TCCCAAAAGTGAGGAAGCCTGGTC -3'
(R):5'- CCCAAACAAGTGATGGTGCTGAAAG -3'

Sequencing Primer
(F):5'- TTGAGCAAAGTCCAGTTGAGC -3'
(R):5'- CCATTTACATATGACCTGAAAGAGG -3'
Posted On2013-11-07