Incidental Mutation 'R0962:Pla2g4d'
ID81237
Institutional Source Beutler Lab
Gene Symbol Pla2g4d
Ensembl Gene ENSMUSG00000070719
Gene Namephospholipase A2, group IVD
SynonymsPla2delta, 2610311B01Rik
MMRRC Submission 039091-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R0962 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location120265595-120289197 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 120280617 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000092252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094665]
Predicted Effect probably null
Transcript: ENSMUST00000094665
SMART Domains Protein: ENSMUSP00000092252
Gene: ENSMUSG00000070719

DomainStartEndE-ValueType
C2 32 132 1.12e-18 SMART
PLAc 263 766 3.36e-11 SMART
Meta Mutation Damage Score 0.9488 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 97.9%
  • 20x: 96.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The phospholipase A2 enzyme family, including PLA2G4D, catalyze the hydrolysis of glycerophospholipids at the sn-2 position and then liberate free fatty acids and lysophospholipids (Chiba et al., 2004 [PubMed 14709560]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik T C 5: 98,566,561 probably benign Het
Acaca G A 11: 84,311,303 A196T probably damaging Het
Adamtsl4 T A 3: 95,684,488 R97* probably null Het
Adgrv1 T C 13: 81,405,346 I5470V probably benign Het
Afg3l2 T C 18: 67,405,427 T754A possibly damaging Het
Agfg1 T C 1: 82,886,396 F395S probably damaging Het
Ahnak A G 19: 9,012,848 probably benign Het
Alkbh2 T C 5: 114,123,953 K239E possibly damaging Het
Ankmy1 A T 1: 92,899,568 C87* probably null Het
Apob A G 12: 7,989,191 I461V probably damaging Het
Arap1 C T 7: 101,384,914 P188S possibly damaging Het
Atp12a G A 14: 56,368,413 E64K probably damaging Het
Brca1 A T 11: 101,525,366 H647Q possibly damaging Het
Cachd1 A G 4: 100,983,301 probably benign Het
Cep57 A T 9: 13,808,743 V429D possibly damaging Het
Dip2a T C 10: 76,292,432 probably benign Het
Dmxl2 A T 9: 54,446,412 N757K probably damaging Het
Dock7 G A 4: 98,945,195 T1953I possibly damaging Het
Ebf3 T C 7: 137,225,203 T111A probably damaging Het
Ercc4 T C 16: 13,130,146 I319T probably damaging Het
Fat1 T C 8: 45,033,326 probably benign Het
Gucy2g C T 19: 55,210,284 W809* probably null Het
Hhipl1 A G 12: 108,327,721 K629E probably benign Het
Hmbox1 A T 14: 64,896,774 S126T probably benign Het
Htr1a A G 13: 105,444,324 N24S probably benign Het
Htra3 T A 5: 35,668,356 I185F probably damaging Het
Impg1 C T 9: 80,381,741 D345N probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kdm7a A G 6: 39,147,194 V720A probably benign Het
Kirrel3 A G 9: 35,000,997 D212G possibly damaging Het
Lgals3bp A T 11: 118,393,020 *139K probably null Het
Lrp11 T A 10: 7,590,296 V82D probably benign Het
Mcf2l T C 8: 13,001,964 Y425H probably benign Het
Mfn2 T C 4: 147,882,201 N511S probably benign Het
Micalcl T C 7: 112,380,417 S108P probably damaging Het
Ms4a6c C T 19: 11,471,142 T13M probably benign Het
Naip2 C A 13: 100,179,385 V296F probably damaging Het
Olfr586 A G 7: 103,122,010 V254A possibly damaging Het
Olfr716 T A 7: 107,148,087 F257Y possibly damaging Het
Olfr869 T A 9: 20,137,538 C141S probably damaging Het
P3h2 T C 16: 25,997,248 M172V probably benign Het
Pcolce2 T G 9: 95,670,034 N73K probably benign Het
Ppfia3 A G 7: 45,347,722 probably benign Het
Ptprcap A G 19: 4,156,464 D182G possibly damaging Het
Rabgap1 T C 2: 37,560,469 probably benign Het
Rpain G A 11: 70,975,041 probably null Het
Sdk1 C T 5: 142,161,875 T1754I probably damaging Het
Stag1 T A 9: 100,796,827 L267Q probably damaging Het
Tex9 T C 9: 72,484,092 T92A probably benign Het
Trpa1 T A 1: 14,898,163 I460F possibly damaging Het
Ttn A T 2: 76,950,156 Y1084N probably damaging Het
Utp6 A G 11: 79,941,868 probably benign Het
Zbtb39 C G 10: 127,742,306 Q250E probably benign Het
Other mutations in Pla2g4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Pla2g4d APN 2 120281726 missense probably damaging 1.00
IGL01405:Pla2g4d APN 2 120266823 missense probably benign 0.01
IGL01642:Pla2g4d APN 2 120280636 missense probably damaging 1.00
IGL01657:Pla2g4d APN 2 120275287 missense possibly damaging 0.91
R1564:Pla2g4d UTSW 2 120268903 missense possibly damaging 0.76
R1576:Pla2g4d UTSW 2 120284167 missense probably damaging 1.00
R1667:Pla2g4d UTSW 2 120270150 splice site probably benign
R1680:Pla2g4d UTSW 2 120277750 critical splice donor site probably null
R1712:Pla2g4d UTSW 2 120277490 missense possibly damaging 0.51
R2253:Pla2g4d UTSW 2 120271141 missense probably damaging 0.99
R2919:Pla2g4d UTSW 2 120281627 splice site probably benign
R3122:Pla2g4d UTSW 2 120278903 missense probably benign 0.03
R4420:Pla2g4d UTSW 2 120284163 missense probably benign
R4737:Pla2g4d UTSW 2 120266790 missense probably benign 0.00
R4829:Pla2g4d UTSW 2 120266743 missense probably damaging 1.00
R5032:Pla2g4d UTSW 2 120281695 nonsense probably null
R5530:Pla2g4d UTSW 2 120269555 missense probably benign 0.06
R5677:Pla2g4d UTSW 2 120278948 missense possibly damaging 0.87
R6087:Pla2g4d UTSW 2 120270006 missense probably damaging 1.00
R6088:Pla2g4d UTSW 2 120270006 missense probably damaging 1.00
R6150:Pla2g4d UTSW 2 120269564 missense probably damaging 1.00
R6930:Pla2g4d UTSW 2 120270633 missense probably damaging 1.00
R7240:Pla2g4d UTSW 2 120270349 missense probably damaging 1.00
R7284:Pla2g4d UTSW 2 120284136 missense probably damaging 1.00
R7339:Pla2g4d UTSW 2 120278978 missense probably benign
R7552:Pla2g4d UTSW 2 120284139 missense possibly damaging 0.56
R7607:Pla2g4d UTSW 2 120288976 missense probably benign
R7692:Pla2g4d UTSW 2 120279295 missense possibly damaging 0.84
R7860:Pla2g4d UTSW 2 120266730 missense probably benign 0.13
R7943:Pla2g4d UTSW 2 120266730 missense probably benign 0.13
X0026:Pla2g4d UTSW 2 120277471 missense probably damaging 0.99
X0028:Pla2g4d UTSW 2 120281726 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCAACAGTTCTCCAGCCATCCAG -3'
(R):5'- TTTCACCTTGCCAGACACAGCAGC -3'

Sequencing Primer
(F):5'- GACGGacacacacacacac -3'
(R):5'- GACACAGCAGCGTCTCTC -3'
Posted On2013-11-07