Incidental Mutation 'R0962:Ebf3'
ID81268
Institutional Source Beutler Lab
Gene Symbol Ebf3
Ensembl Gene ENSMUSG00000010476
Gene Nameearly B cell factor 3
SynonymsOlf-1/EBF-like 2, O/E-2, 3110018A08Rik
MMRRC Submission 039091-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0962 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location137193673-137314445 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 137225203 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 111 (T111A)
Ref Sequence ENSEMBL: ENSMUSP00000147512 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033378] [ENSMUST00000106118] [ENSMUST00000168203] [ENSMUST00000169486] [ENSMUST00000209578] [ENSMUST00000210774]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033378
AA Change: T318A

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000033378
Gene: ENSMUSG00000010476
AA Change: T318A

DomainStartEndE-ValueType
low complexity region 94 106 N/A INTRINSIC
IPT 253 337 2.09e-7 SMART
HLH 338 387 1.43e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106118
AA Change: T318A

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101724
Gene: ENSMUSG00000010476
AA Change: T318A

DomainStartEndE-ValueType
Pfam:COE1_DBD 17 247 2.6e-151 PFAM
IPT 262 346 2.09e-7 SMART
HLH 347 396 1.43e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168203
AA Change: T318A

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000130334
Gene: ENSMUSG00000010476
AA Change: T318A

DomainStartEndE-ValueType
low complexity region 94 106 N/A INTRINSIC
IPT 253 337 2.09e-7 SMART
HLH 338 387 1.43e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000169486
AA Change: T318A

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000132563
Gene: ENSMUSG00000010476
AA Change: T318A

DomainStartEndE-ValueType
low complexity region 94 106 N/A INTRINSIC
IPT 253 337 2.09e-7 SMART
HLH 338 387 1.43e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000209578
AA Change: T111A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209905
Predicted Effect possibly damaging
Transcript: ENSMUST00000210774
AA Change: T327A

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
Meta Mutation Damage Score 0.8205 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 97.9%
  • 20x: 96.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the early B-cell factor (EBF) family of DNA binding transcription factors. EBF proteins are involved in B-cell differentiation, bone development and neurogenesis, and may also function as tumor suppressors. The encoded protein inhibits cell survival through the regulation of genes involved in cell cycle arrest and apoptosis, and aberrant methylation or deletion of this gene may play a role in multiple malignancies including glioblastoma multiforme and gastric carcinoma. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous mutant mice die perinatally and exhibit impaired olfactory neuron projection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik T C 5: 98,566,561 probably benign Het
Acaca G A 11: 84,311,303 A196T probably damaging Het
Adamtsl4 T A 3: 95,684,488 R97* probably null Het
Adgrv1 T C 13: 81,405,346 I5470V probably benign Het
Afg3l2 T C 18: 67,405,427 T754A possibly damaging Het
Agfg1 T C 1: 82,886,396 F395S probably damaging Het
Ahnak A G 19: 9,012,848 probably benign Het
Alkbh2 T C 5: 114,123,953 K239E possibly damaging Het
Ankmy1 A T 1: 92,899,568 C87* probably null Het
Apob A G 12: 7,989,191 I461V probably damaging Het
Arap1 C T 7: 101,384,914 P188S possibly damaging Het
Atp12a G A 14: 56,368,413 E64K probably damaging Het
Brca1 A T 11: 101,525,366 H647Q possibly damaging Het
Cachd1 A G 4: 100,983,301 probably benign Het
Cep57 A T 9: 13,808,743 V429D possibly damaging Het
Dip2a T C 10: 76,292,432 probably benign Het
Dmxl2 A T 9: 54,446,412 N757K probably damaging Het
Dock7 G A 4: 98,945,195 T1953I possibly damaging Het
Ercc4 T C 16: 13,130,146 I319T probably damaging Het
Fat1 T C 8: 45,033,326 probably benign Het
Gucy2g C T 19: 55,210,284 W809* probably null Het
Hhipl1 A G 12: 108,327,721 K629E probably benign Het
Hmbox1 A T 14: 64,896,774 S126T probably benign Het
Htr1a A G 13: 105,444,324 N24S probably benign Het
Htra3 T A 5: 35,668,356 I185F probably damaging Het
Impg1 C T 9: 80,381,741 D345N probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kdm7a A G 6: 39,147,194 V720A probably benign Het
Kirrel3 A G 9: 35,000,997 D212G possibly damaging Het
Lgals3bp A T 11: 118,393,020 *139K probably null Het
Lrp11 T A 10: 7,590,296 V82D probably benign Het
Mcf2l T C 8: 13,001,964 Y425H probably benign Het
Mfn2 T C 4: 147,882,201 N511S probably benign Het
Micalcl T C 7: 112,380,417 S108P probably damaging Het
Ms4a6c C T 19: 11,471,142 T13M probably benign Het
Naip2 C A 13: 100,179,385 V296F probably damaging Het
Olfr586 A G 7: 103,122,010 V254A possibly damaging Het
Olfr716 T A 7: 107,148,087 F257Y possibly damaging Het
Olfr869 T A 9: 20,137,538 C141S probably damaging Het
P3h2 T C 16: 25,997,248 M172V probably benign Het
Pcolce2 T G 9: 95,670,034 N73K probably benign Het
Pla2g4d A G 2: 120,280,617 probably null Het
Ppfia3 A G 7: 45,347,722 probably benign Het
Ptprcap A G 19: 4,156,464 D182G possibly damaging Het
Rabgap1 T C 2: 37,560,469 probably benign Het
Rpain G A 11: 70,975,041 probably null Het
Sdk1 C T 5: 142,161,875 T1754I probably damaging Het
Stag1 T A 9: 100,796,827 L267Q probably damaging Het
Tex9 T C 9: 72,484,092 T92A probably benign Het
Trpa1 T A 1: 14,898,163 I460F possibly damaging Het
Ttn A T 2: 76,950,156 Y1084N probably damaging Het
Utp6 A G 11: 79,941,868 probably benign Het
Zbtb39 C G 10: 127,742,306 Q250E probably benign Het
Other mutations in Ebf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Ebf3 APN 7 137225896 splice site probably benign
IGL01938:Ebf3 APN 7 137309318 missense probably damaging 1.00
IGL02076:Ebf3 APN 7 137231301 missense possibly damaging 0.61
IGL02260:Ebf3 APN 7 137206190 missense probably damaging 1.00
IGL02303:Ebf3 APN 7 137309365 missense probably benign 0.01
IGL02828:Ebf3 APN 7 137307518 missense probably damaging 0.98
IGL03211:Ebf3 APN 7 137231304 missense probably benign 0.21
R0885:Ebf3 UTSW 7 137225884 missense probably benign 0.10
R1166:Ebf3 UTSW 7 137313167 splice site probably benign
R1255:Ebf3 UTSW 7 137225212 missense probably benign 0.35
R1804:Ebf3 UTSW 7 137200521 missense possibly damaging 0.89
R4298:Ebf3 UTSW 7 137225229 missense possibly damaging 0.95
R4393:Ebf3 UTSW 7 137225157 missense probably damaging 0.99
R5061:Ebf3 UTSW 7 137313559 missense possibly damaging 0.57
R5880:Ebf3 UTSW 7 137198638 missense probably benign 0.04
R6024:Ebf3 UTSW 7 137200535 missense probably damaging 1.00
R6109:Ebf3 UTSW 7 137206226 missense probably damaging 1.00
R6634:Ebf3 UTSW 7 137201160 missense probably damaging 0.99
R6958:Ebf3 UTSW 7 137199265 missense possibly damaging 0.66
R6997:Ebf3 UTSW 7 137225265 missense probably damaging 0.97
R7578:Ebf3 UTSW 7 137313532 missense probably damaging 1.00
R7771:Ebf3 UTSW 7 137309363 missense probably damaging 1.00
R8133:Ebf3 UTSW 7 137313143 missense probably damaging 1.00
RF022:Ebf3 UTSW 7 137313942 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AAGGTCACACTACCGTGTCTGTCC -3'
(R):5'- TCCGAGACGATGGTCCAATTTATGC -3'

Sequencing Primer
(F):5'- CCAGTCATCATGAGCTGTCTAAG -3'
(R):5'- CGATGGTCCAATTTATGCTCATTTTG -3'
Posted On2013-11-07