Incidental Mutation 'R0938:Pard6g'
ID81271
Institutional Source Beutler Lab
Gene Symbol Pard6g
Ensembl Gene ENSMUSG00000056214
Gene Namepar-6 family cell polarity regulator gamma
Synonyms2410049N21Rik
MMRRC Submission 039077-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R0938 (G1)
Quality Score206
Status Not validated
Chromosome18
Chromosomal Location80046895-80119640 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 80080044 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 98 (R98*)
Ref Sequence ENSEMBL: ENSMUSP00000069182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070219]
Predicted Effect probably null
Transcript: ENSMUST00000070219
AA Change: R98*
SMART Domains Protein: ENSMUSP00000069182
Gene: ENSMUSG00000056214
AA Change: R98*

DomainStartEndE-ValueType
PB1 18 98 1.16e-16 SMART
PDZ 168 251 8.6e-14 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 95.7%
  • 20x: 88.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI413582 T C 17: 27,564,394 K43R possibly damaging Het
Bcan A G 3: 87,993,154 S591P possibly damaging Het
Chfr T C 5: 110,164,058 L579P probably damaging Het
Dab2 C T 15: 6,435,384 T439I probably benign Het
Dazap1 T C 10: 80,280,961 S165P possibly damaging Het
Dlx2 C A 2: 71,544,668 W284L possibly damaging Het
Dync2h1 A T 9: 7,002,658 N3803K probably benign Het
Dynlrb2 A C 8: 116,514,968 probably null Het
Fhl2 A G 1: 43,141,706 I108T possibly damaging Het
Fntb A G 12: 76,916,440 Y399C probably damaging Het
Galnt18 T C 7: 111,519,999 I438M possibly damaging Het
Gnmt A G 17: 46,726,345 L171P probably damaging Het
Gpc1 G A 1: 92,857,309 R358H possibly damaging Het
Ifi204 A T 1: 173,751,745 N511K possibly damaging Het
Klhl1 A T 14: 96,152,040 Y559* probably null Het
Mob1b T A 5: 88,749,593 I120N probably damaging Het
Mybpc2 T C 7: 44,506,887 K834R probably benign Het
Oosp2 G A 19: 11,651,540 Q66* probably null Het
P4ha2 A G 11: 54,119,322 K302E possibly damaging Het
Pkdrej G A 15: 85,818,163 P1191S probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ubap2 A C 4: 41,202,304 L708R probably damaging Het
Zfp638 G A 6: 83,984,041 V1204I probably benign Het
Zfp865 G T 7: 5,031,404 C796F possibly damaging Het
Zmiz2 A T 11: 6,397,185 M237L probably benign Het
Other mutations in Pard6g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Pard6g APN 18 80079822 splice site probably benign
IGL01514:Pard6g APN 18 80117446 missense probably damaging 1.00
IGL01519:Pard6g APN 18 80079856 missense probably benign 0.34
IGL02305:Pard6g APN 18 80117770 missense probably damaging 1.00
IGL03115:Pard6g APN 18 80079853 missense probably damaging 1.00
R0411:Pard6g UTSW 18 80117122 missense probably damaging 1.00
R0604:Pard6g UTSW 18 80117208 missense probably damaging 1.00
R1730:Pard6g UTSW 18 80079825 missense probably damaging 0.97
R1783:Pard6g UTSW 18 80079825 missense probably damaging 0.97
R1785:Pard6g UTSW 18 80117308 missense probably damaging 0.96
R1786:Pard6g UTSW 18 80117308 missense probably damaging 0.96
R1851:Pard6g UTSW 18 80117142 missense probably damaging 1.00
R2070:Pard6g UTSW 18 80117725 missense probably benign 0.00
R2132:Pard6g UTSW 18 80117308 missense probably damaging 0.96
R2133:Pard6g UTSW 18 80117308 missense probably damaging 0.96
R3778:Pard6g UTSW 18 80079823 critical splice acceptor site probably null
R5282:Pard6g UTSW 18 80079901 missense probably benign 0.01
R6084:Pard6g UTSW 18 80117205 missense possibly damaging 0.73
R6913:Pard6g UTSW 18 80117319 missense possibly damaging 0.94
R7124:Pard6g UTSW 18 80117125 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- GCCACAAGCCTGGGAAGTTTGAAG -3'
(R):5'- GCATTTCTGAGAGGAAGGCAGACTG -3'

Sequencing Primer
(F):5'- CCTGGGAAGTTTGAAGATTTCTACC -3'
(R):5'- ACTGAATCTCAGAGCCCCATAC -3'
Posted On2013-11-07