Incidental Mutation 'R0938:Oosp2'
ID81273
Institutional Source Beutler Lab
Gene Symbol Oosp2
Ensembl Gene ENSMUSG00000055895
Gene Nameoocyte secreted protein 2
SynonymsLOC225922, Tmem122, Plac1l
MMRRC Submission 039077-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R0938 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location11647279-11660559 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 11651540 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 66 (Q66*)
Ref Sequence ENSEMBL: ENSMUSP00000113931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121793] [ENSMUST00000135994]
Predicted Effect probably null
Transcript: ENSMUST00000069681
AA Change: Q66*
SMART Domains Protein: ENSMUSP00000065120
Gene: ENSMUSG00000055895
AA Change: Q66*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Zona_pellucida 30 165 7.1e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000121793
AA Change: Q66*
SMART Domains Protein: ENSMUSP00000113931
Gene: ENSMUSG00000055895
AA Change: Q66*

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135994
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 95.7%
  • 20x: 88.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI413582 T C 17: 27,564,394 K43R possibly damaging Het
Bcan A G 3: 87,993,154 S591P possibly damaging Het
Chfr T C 5: 110,164,058 L579P probably damaging Het
Dab2 C T 15: 6,435,384 T439I probably benign Het
Dazap1 T C 10: 80,280,961 S165P possibly damaging Het
Dlx2 C A 2: 71,544,668 W284L possibly damaging Het
Dync2h1 A T 9: 7,002,658 N3803K probably benign Het
Dynlrb2 A C 8: 116,514,968 probably null Het
Fhl2 A G 1: 43,141,706 I108T possibly damaging Het
Fntb A G 12: 76,916,440 Y399C probably damaging Het
Galnt18 T C 7: 111,519,999 I438M possibly damaging Het
Gnmt A G 17: 46,726,345 L171P probably damaging Het
Gpc1 G A 1: 92,857,309 R358H possibly damaging Het
Ifi204 A T 1: 173,751,745 N511K possibly damaging Het
Klhl1 A T 14: 96,152,040 Y559* probably null Het
Mob1b T A 5: 88,749,593 I120N probably damaging Het
Mybpc2 T C 7: 44,506,887 K834R probably benign Het
P4ha2 A G 11: 54,119,322 K302E possibly damaging Het
Pard6g C T 18: 80,080,044 R98* probably null Het
Pkdrej G A 15: 85,818,163 P1191S probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ubap2 A C 4: 41,202,304 L708R probably damaging Het
Zfp638 G A 6: 83,984,041 V1204I probably benign Het
Zfp865 G T 7: 5,031,404 C796F possibly damaging Het
Zmiz2 A T 11: 6,397,185 M237L probably benign Het
Other mutations in Oosp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Oosp2 APN 19 11647461 missense probably damaging 1.00
IGL01813:Oosp2 APN 19 11651483 missense probably benign 0.14
IGL01818:Oosp2 APN 19 11649689 missense probably benign 0.02
IGL02484:Oosp2 APN 19 11651483 missense probably benign 0.14
IGL03358:Oosp2 APN 19 11651569 nonsense probably null
R1867:Oosp2 UTSW 19 11649595 critical splice donor site probably null
R1944:Oosp2 UTSW 19 11649595 critical splice donor site probably null
R1945:Oosp2 UTSW 19 11649595 critical splice donor site probably null
R2149:Oosp2 UTSW 19 11649614 nonsense probably null
R4604:Oosp2 UTSW 19 11649683 missense probably benign 0.01
R4684:Oosp2 UTSW 19 11649653 missense probably damaging 0.98
R5034:Oosp2 UTSW 19 11651535 missense probably damaging 0.99
R6034:Oosp2 UTSW 19 11651515 missense probably damaging 1.00
R6034:Oosp2 UTSW 19 11651515 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGTGATCTGGAGCGTTAGAAGC -3'
(R):5'- GCTCCTTCTTGAAGTTAATGCACACTTG -3'

Sequencing Primer
(F):5'- tccaagcacccacatcag -3'
(R):5'- GTTAATGCACACTTGACATTTTCTC -3'
Posted On2013-11-07