Incidental Mutation 'R0939:Olfr1013'
ID81283
Institutional Source Beutler Lab
Gene Symbol Olfr1013
Ensembl Gene ENSMUSG00000053287
Gene Nameolfactory receptor 1013
SynonymsMOR213-2, GA_x6K02T2Q125-47248551-47249468
MMRRC Submission 039078-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R0939 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location85767098-85774649 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 85770653 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 284 (L284*)
Ref Sequence ENSEMBL: ENSMUSP00000150201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065626] [ENSMUST00000213453] [ENSMUST00000216397]
Predicted Effect probably null
Transcript: ENSMUST00000065626
AA Change: L284*
SMART Domains Protein: ENSMUSP00000068173
Gene: ENSMUSG00000053287
AA Change: L284*

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 3.3e-50 PFAM
Pfam:7tm_1 40 289 1e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000213453
Predicted Effect probably null
Transcript: ENSMUST00000216397
AA Change: L284*
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C T 11: 120,012,143 V419M probably damaging Het
Cdcp1 A G 9: 123,183,690 V264A probably damaging Het
Cfap53 A G 18: 74,305,730 D326G probably null Het
Dach1 A G 14: 97,915,924 V436A probably damaging Het
Dnah11 C T 12: 118,060,407 G1870S probably damaging Het
Dst C A 1: 34,244,383 H5324N probably damaging Het
Eapp TTTCTTCTTCTTCTTCTT TTTCTTCTTCTTCTT 12: 54,685,949 probably benign Het
Esd C A 14: 74,736,027 H21N probably damaging Het
Gnmt A G 17: 46,726,345 L171P probably damaging Het
Igdcc4 T A 9: 65,131,473 probably null Het
Mug1 A T 6: 121,884,349 I1310F possibly damaging Het
Mybpc2 T C 7: 44,506,887 K834R probably benign Het
Olfr1564 T C 17: 33,215,661 K231E possibly damaging Het
Olfr516 T A 7: 108,845,233 Y259F probably damaging Het
Pcdh17 A G 14: 84,447,755 D554G probably damaging Het
Plcxd3 T A 15: 4,516,862 L116* probably null Het
Prss1 A C 6: 41,463,588 D199A probably damaging Het
Rbms3 C T 9: 117,109,960 probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rreb1 A G 13: 37,932,231 M1189V probably benign Het
Slc25a39 T C 11: 102,405,051 E118G probably damaging Het
Slfn5 G T 11: 82,961,338 M763I probably benign Het
Speer4f2 A G 5: 17,374,404 E67G probably damaging Het
Spef2 A T 15: 9,704,550 probably null Het
Spocd1 A T 4: 129,948,870 D26V possibly damaging Het
Ssh1 A G 5: 113,970,436 L50P probably damaging Het
Tle1 A G 4: 72,118,534 L728P probably damaging Het
Trio A G 15: 27,741,250 probably null Het
Tubb1 G A 2: 174,455,756 E53K probably damaging Het
Vmn2r71 A T 7: 85,623,681 T568S possibly damaging Het
Other mutations in Olfr1013
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01944:Olfr1013 APN 2 85770040 missense probably damaging 0.99
R0523:Olfr1013 UTSW 2 85769929 missense probably benign
R1400:Olfr1013 UTSW 2 85770133 missense possibly damaging 0.87
R1710:Olfr1013 UTSW 2 85769855 missense probably benign 0.32
R2150:Olfr1013 UTSW 2 85769998 missense probably damaging 1.00
R2428:Olfr1013 UTSW 2 85769978 missense probably damaging 1.00
R4730:Olfr1013 UTSW 2 85770061 nonsense probably null
R5101:Olfr1013 UTSW 2 85769924 missense probably damaging 0.97
R5632:Olfr1013 UTSW 2 85770269 missense probably benign
R5849:Olfr1013 UTSW 2 85770424 missense probably benign 0.00
R6175:Olfr1013 UTSW 2 85770308 missense probably benign 0.07
R6454:Olfr1013 UTSW 2 85770373 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCCCACCTCTGGTAAAGCTCGCAT -3'
(R):5'- CAGCACACATTTGGAAAGATAGGCTGT -3'

Sequencing Primer
(F):5'- CAATGTCATCATCCCCATTGTG -3'
(R):5'- gttactattcctgcaataaacacaag -3'
Posted On2013-11-07