Incidental Mutation 'R0939:Spocd1'
ID81291
Institutional Source Beutler Lab
Gene Symbol Spocd1
Ensembl Gene ENSMUSG00000028784
Gene NameSPOC domain containing 1
SynonymsOTTMUSG00000009522
MMRRC Submission 039078-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R0939 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location129929249-129957115 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 129948870 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 26 (D26V)
Ref Sequence ENSEMBL: ENSMUSP00000118383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084263] [ENSMUST00000128007]
Predicted Effect probably benign
Transcript: ENSMUST00000084263
AA Change: D382V

PolyPhen 2 Score 0.410 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000081284
Gene: ENSMUSG00000028784
AA Change: D382V

DomainStartEndE-ValueType
Pfam:TFIIS_M 1 105 1.7e-24 PFAM
Blast:PAC 123 163 4e-7 BLAST
Pfam:SPOC 247 350 1e-22 PFAM
low complexity region 454 467 N/A INTRINSIC
low complexity region 559 571 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000128007
AA Change: D26V

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118383
Gene: ENSMUSG00000028784
AA Change: D26V

DomainStartEndE-ValueType
Pfam:TFIIS_M 5 113 3.6e-28 PFAM
Blast:PAC 129 157 6e-7 BLAST
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the TFIIS family of transcription factors. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C T 11: 120,012,143 V419M probably damaging Het
Cdcp1 A G 9: 123,183,690 V264A probably damaging Het
Cfap53 A G 18: 74,305,730 D326G probably null Het
Dach1 A G 14: 97,915,924 V436A probably damaging Het
Dnah11 C T 12: 118,060,407 G1870S probably damaging Het
Dst C A 1: 34,244,383 H5324N probably damaging Het
Eapp TTTCTTCTTCTTCTTCTT TTTCTTCTTCTTCTT 12: 54,685,949 probably benign Het
Esd C A 14: 74,736,027 H21N probably damaging Het
Gnmt A G 17: 46,726,345 L171P probably damaging Het
Igdcc4 T A 9: 65,131,473 probably null Het
Mug1 A T 6: 121,884,349 I1310F possibly damaging Het
Mybpc2 T C 7: 44,506,887 K834R probably benign Het
Olfr1013 T A 2: 85,770,653 L284* probably null Het
Olfr1564 T C 17: 33,215,661 K231E possibly damaging Het
Olfr516 T A 7: 108,845,233 Y259F probably damaging Het
Pcdh17 A G 14: 84,447,755 D554G probably damaging Het
Plcxd3 T A 15: 4,516,862 L116* probably null Het
Prss1 A C 6: 41,463,588 D199A probably damaging Het
Rbms3 C T 9: 117,109,960 probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rreb1 A G 13: 37,932,231 M1189V probably benign Het
Slc25a39 T C 11: 102,405,051 E118G probably damaging Het
Slfn5 G T 11: 82,961,338 M763I probably benign Het
Speer4f2 A G 5: 17,374,404 E67G probably damaging Het
Spef2 A T 15: 9,704,550 probably null Het
Ssh1 A G 5: 113,970,436 L50P probably damaging Het
Tle1 A G 4: 72,118,534 L728P probably damaging Het
Trio A G 15: 27,741,250 probably null Het
Tubb1 G A 2: 174,455,756 E53K probably damaging Het
Vmn2r71 A T 7: 85,623,681 T568S possibly damaging Het
Other mutations in Spocd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02191:Spocd1 APN 4 129953587 missense probably damaging 0.99
IGL02332:Spocd1 APN 4 129949092 missense probably damaging 1.00
IGL02796:Spocd1 APN 4 129947755 intron probably benign
R0005:Spocd1 UTSW 4 129956778 missense possibly damaging 0.73
R0499:Spocd1 UTSW 4 129955470 missense possibly damaging 0.56
R1128:Spocd1 UTSW 4 129956806 missense possibly damaging 0.57
R5747:Spocd1 UTSW 4 129954945 missense probably damaging 1.00
R5774:Spocd1 UTSW 4 129951786 missense probably benign 0.04
R5872:Spocd1 UTSW 4 129956461 missense probably damaging 0.99
R5887:Spocd1 UTSW 4 129948959 missense probably damaging 1.00
R6185:Spocd1 UTSW 4 129956449 missense probably benign 0.02
R6198:Spocd1 UTSW 4 129955415 missense probably damaging 1.00
R6245:Spocd1 UTSW 4 129957108 unclassified probably null
R6412:Spocd1 UTSW 4 129953572 missense probably benign 0.44
R6804:Spocd1 UTSW 4 129953630 nonsense probably null
R6884:Spocd1 UTSW 4 129955404 unclassified probably benign
R6898:Spocd1 UTSW 4 129956512 unclassified probably benign
R7090:Spocd1 UTSW 4 129953898 missense
R7548:Spocd1 UTSW 4 129929809 missense
R7570:Spocd1 UTSW 4 129930164 missense
R7657:Spocd1 UTSW 4 129929742 missense
R7910:Spocd1 UTSW 4 129930100 missense
R7991:Spocd1 UTSW 4 129930100 missense
Predicted Primers PCR Primer
(F):5'- ATCTTCTGCACAGAGCAAGGGC -3'
(R):5'- TTTTCCAAACCTGCGGTTGGGC -3'

Sequencing Primer
(F):5'- GCAGGAGTCAACAGGTCC -3'
(R):5'- ACAACATTTCGGGGATCTCG -3'
Posted On2013-11-07