Mutagenetix > Incidental Mutations

Incidental Mutation 'R0939:Speer4f2'

81293

Institutional Source

Beutler Lab

Gene Symbol

Speer4f2

Ensembl Gene

ENSMUSG00000091827

Gene Name

spermatogenesis associated glutamate (E)-rich protein 4f2

Synonyms

Gm3535, Gm3495

MMRRC Submission

039078-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.140) question?

Stock #

R0939 (G1)

Quality Score

220

Status

Not validated

Chromosome

Chromosomal Location

17373180-17378028 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 17374404 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 67 (E67G)

Ref Sequence

ENSEMBL: ENSMUSP00000129818 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166086]

AlphaFold

E9Q366

Predicted Effect

probably damaging
Transcript: ENSMUST00000166086
AA Change: E67G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000129818
Gene: ENSMUSG00000091827
AA Change: E67G

Domain	Start	End	E-Value	Type
Pfam:Takusan	34	112	9.6e-20	PFAM
low complexity region	208	253	N/A	INTRINSIC

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.3%
20x: 94.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatk	C	T	11: 120,012,143	V419M	probably damaging	Het
Cdcp1	A	G	9: 123,183,690	V264A	probably damaging	Het
Cfap53	A	G	18: 74,305,730	D326G	probably null	Het
Dach1	A	G	14: 97,915,924	V436A	probably damaging	Het
Dnah11	C	T	12: 118,060,407	G1870S	probably damaging	Het
Dst	C	A	1: 34,244,383	H5324N	probably damaging	Het
Eapp	TTTCTTCTTCTTCTTCTT	TTTCTTCTTCTTCTT	12: 54,685,949		probably benign	Het
Esd	C	A	14: 74,736,027	H21N	probably damaging	Het
Gnmt	A	G	17: 46,726,345	L171P	probably damaging	Het
Igdcc4	T	A	9: 65,131,473		probably null	Het
Mug1	A	T	6: 121,884,349	I1310F	possibly damaging	Het
Mybpc2	T	C	7: 44,506,887	K834R	probably benign	Het
Olfr1013	T	A	2: 85,770,653	L284*	probably null	Het
Olfr1564	T	C	17: 33,215,661	K231E	possibly damaging	Het
Olfr516	T	A	7: 108,845,233	Y259F	probably damaging	Het
Pcdh17	A	G	14: 84,447,755	D554G	probably damaging	Het
Plcxd3	T	A	15: 4,516,862	L116*	probably null	Het
Prss1	A	C	6: 41,463,588	D199A	probably damaging	Het
Rbms3	C	T	9: 117,109,960		probably null	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Rreb1	A	G	13: 37,932,231	M1189V	probably benign	Het
Slc25a39	T	C	11: 102,405,051	E118G	probably damaging	Het
Slfn5	G	T	11: 82,961,338	M763I	probably benign	Het
Spef2	A	T	15: 9,704,550		probably null	Het
Spocd1	A	T	4: 129,948,870	D26V	possibly damaging	Het
Ssh1	A	G	5: 113,970,436	L50P	probably damaging	Het
Tle1	A	G	4: 72,118,534	L728P	probably damaging	Het
Trio	A	G	15: 27,741,250		probably null	Het
Tubb1	G	A	2: 174,455,756	E53K	probably damaging	Het
Vmn2r71	A	T	7: 85,623,681	T568S	possibly damaging	Het

Other mutations in Speer4f2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01505:Speer4f2	APN	5	17376567	missense	possibly damaging	0.94
IGL02092:Speer4f2	APN	5	17376629	nonsense	probably null
IGL03100:Speer4f2	APN	5	17376530	missense	probably damaging	0.99
R1384:Speer4f2	UTSW	5	17374449	missense	probably damaging	1.00
R1528:Speer4f2	UTSW	5	17376542	missense
R1873:Speer4f2	UTSW	5	17374449	missense	probably damaging	1.00
R3608:Speer4f2	UTSW	5	17374494	missense	probably benign	0.03
R4972:Speer4f2	UTSW	5	17374425	missense	probably benign	0.27
R5421:Speer4f2	UTSW	5	17374358	missense	possibly damaging	0.88
R5450:Speer4f2	UTSW	5	17373219	missense	possibly damaging	0.85
R5452:Speer4f2	UTSW	5	17376500	missense	possibly damaging	0.93
R5531:Speer4f2	UTSW	5	17376528	missense	possibly damaging	0.57
R5924:Speer4f2	UTSW	5	17376624	missense	probably damaging	1.00
R6454:Speer4f2	UTSW	5	17374433	missense	probably damaging	0.99
R6553:Speer4f2	UTSW	5	17374422	missense	probably damaging	1.00
R6585:Speer4f2	UTSW	5	17374422	missense	probably damaging	1.00
R6649:Speer4f2	UTSW	5	17375769	missense	probably benign	0.05
R6878:Speer4f2	UTSW	5	17375767	missense	probably damaging	0.99
R7089:Speer4f2	UTSW	5	17376663	missense
R7129:Speer4f2	UTSW	5	17377448	missense
R7448:Speer4f2	UTSW	5	17376542	missense
R7654:Speer4f2	UTSW	5	17374415	missense
R7942:Speer4f2	UTSW	5	17377632	missense	unknown
R8170:Speer4f2	UTSW	5	17374461	missense
R8409:Speer4f2	UTSW	5	17377421	missense
R9154:Speer4f2	UTSW	5	17376612	missense

Predicted Primers

PCR Primer
(F):5'- GAAGACTGGGGAAACATCTGGCTAC -3'
(R):5'- TAGATGCTACCTGGAGGTTCCAGC -3'

Sequencing Primer
(F):5'- GGGAAACATCTGGCTACTTGTATC -3'
(R):5'- GGACCAGAAGAGTCTATTTCCC -3'

Posted On

2013-11-07