Mutagenetix > Incidental Mutations

Incidental Mutation 'R0939:Ssh1'

81295

Institutional Source

Beutler Lab

Gene Symbol

Ssh1

Ensembl Gene

ENSMUSG00000042121

Gene Name

slingshot protein phosphatase 1

Synonyms

mSSH-1L, LOC384311

MMRRC Submission

039078-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0939 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

113937094-113993894 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 113970436 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 50 (L50P)

Ref Sequence

ENSEMBL: ENSMUSP00000124312 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077689] [ENSMUST00000112298] [ENSMUST00000159510] [ENSMUST00000159592] [ENSMUST00000162396]

Predicted Effect

probably damaging
Transcript: ENSMUST00000077689
AA Change: L7P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000076873
Gene: ENSMUSG00000042121
AA Change: L7P

Domain	Start	End	E-Value	Type
Pfam:DEK_C	208	261	1.1e-19	PFAM
DSPc	265	403	7.82e-47	SMART
low complexity region	490	503	N/A	INTRINSIC
low complexity region	654	669	N/A	INTRINSIC
low complexity region	686	704	N/A	INTRINSIC
low complexity region	732	748	N/A	INTRINSIC
low complexity region	874	892	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000112298
AA Change: L50P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107917
Gene: ENSMUSG00000042121
AA Change: L50P

Domain	Start	End	E-Value	Type
low complexity region	13	22	N/A	INTRINSIC
Pfam:DEK_C	229	282	9.5e-20	PFAM
DSPc	286	424	7.82e-47	SMART
low complexity region	511	524	N/A	INTRINSIC
low complexity region	675	690	N/A	INTRINSIC
low complexity region	707	725	N/A	INTRINSIC
low complexity region	753	769	N/A	INTRINSIC
low complexity region	895	913	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000159510

Predicted Effect

probably damaging
Transcript: ENSMUST00000159592
AA Change: L50P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000124312
Gene: ENSMUSG00000042121
AA Change: L50P

Domain	Start	End	E-Value	Type
low complexity region	13	22	N/A	INTRINSIC
Pfam:DEK_C	252	303	2.3e-17	PFAM
DSPc	308	446	7.82e-47	SMART
low complexity region	533	546	N/A	INTRINSIC
low complexity region	697	712	N/A	INTRINSIC
low complexity region	729	747	N/A	INTRINSIC
low complexity region	775	791	N/A	INTRINSIC
low complexity region	917	935	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162322

Predicted Effect

probably benign
Transcript: ENSMUST00000162396

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.3%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the slingshot homolog (SSH) family of phosphatases, which regulate actin filament dynamics. The SSH proteins dephosphorylate and activate the actin binding/depolymerizing factor cofilin, which subsequently binds to actin filaments and stimulates their disassembly. Cofilin is inactivated by kinases such as LIM domain kinase-1 (LIMK1), which may also be dephosphorylated and inactivated by SSH proteins. The SSH family thus appears to play a role in actin dynamics by reactivating cofilin proteins. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatk	C	T	11: 120,012,143	V419M	probably damaging	Het
Cdcp1	A	G	9: 123,183,690	V264A	probably damaging	Het
Cfap53	A	G	18: 74,305,730	D326G	probably null	Het
Dach1	A	G	14: 97,915,924	V436A	probably damaging	Het
Dnah11	C	T	12: 118,060,407	G1870S	probably damaging	Het
Dst	C	A	1: 34,244,383	H5324N	probably damaging	Het
Eapp	TTTCTTCTTCTTCTTCTT	TTTCTTCTTCTTCTT	12: 54,685,949		probably benign	Het
Esd	C	A	14: 74,736,027	H21N	probably damaging	Het
Gnmt	A	G	17: 46,726,345	L171P	probably damaging	Het
Igdcc4	T	A	9: 65,131,473		probably null	Het
Mug1	A	T	6: 121,884,349	I1310F	possibly damaging	Het
Mybpc2	T	C	7: 44,506,887	K834R	probably benign	Het
Olfr1013	T	A	2: 85,770,653	L284*	probably null	Het
Olfr1564	T	C	17: 33,215,661	K231E	possibly damaging	Het
Olfr516	T	A	7: 108,845,233	Y259F	probably damaging	Het
Pcdh17	A	G	14: 84,447,755	D554G	probably damaging	Het
Plcxd3	T	A	15: 4,516,862	L116*	probably null	Het
Prss1	A	C	6: 41,463,588	D199A	probably damaging	Het
Rbms3	C	T	9: 117,109,960		probably null	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Rreb1	A	G	13: 37,932,231	M1189V	probably benign	Het
Slc25a39	T	C	11: 102,405,051	E118G	probably damaging	Het
Slfn5	G	T	11: 82,961,338	M763I	probably benign	Het
Speer4f2	A	G	5: 17,374,404	E67G	probably damaging	Het
Spef2	A	T	15: 9,704,550		probably null	Het
Spocd1	A	T	4: 129,948,870	D26V	possibly damaging	Het
Tle1	A	G	4: 72,118,534	L728P	probably damaging	Het
Trio	A	G	15: 27,741,250		probably null	Het
Tubb1	G	A	2: 174,455,756	E53K	probably damaging	Het
Vmn2r71	A	T	7: 85,623,681	T568S	possibly damaging	Het

Other mutations in Ssh1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00235:Ssh1	APN	5	113942576	missense	probably damaging	1.00
IGL01432:Ssh1	APN	5	113958822	missense	probably benign	0.31
IGL01933:Ssh1	APN	5	113950380	splice site	probably benign
IGL01951:Ssh1	APN	5	113966247	missense	possibly damaging	0.64
IGL02117:Ssh1	APN	5	113946480	nonsense	probably null
IGL02391:Ssh1	APN	5	113942517	missense	probably damaging	1.00
R0110:Ssh1	UTSW	5	113946705	missense	probably benign	0.00
R0469:Ssh1	UTSW	5	113946705	missense	probably benign	0.00
R0510:Ssh1	UTSW	5	113946705	missense	probably benign	0.00
R0682:Ssh1	UTSW	5	113960657	missense	probably damaging	1.00
R0863:Ssh1	UTSW	5	113966731	missense	probably damaging	1.00
R1539:Ssh1	UTSW	5	113952003	missense	probably damaging	1.00
R1716:Ssh1	UTSW	5	113952020	missense	possibly damaging	0.80
R1754:Ssh1	UTSW	5	113955845	missense	probably damaging	0.99
R1867:Ssh1	UTSW	5	113943451	missense	probably damaging	1.00
R2261:Ssh1	UTSW	5	113942703	missense	possibly damaging	0.94
R2262:Ssh1	UTSW	5	113942703	missense	possibly damaging	0.94
R2497:Ssh1	UTSW	5	113958858	missense	probably damaging	1.00
R3774:Ssh1	UTSW	5	113966722	missense	probably damaging	1.00
R3922:Ssh1	UTSW	5	113942708	missense	possibly damaging	0.52
R5120:Ssh1	UTSW	5	113957398	missense	possibly damaging	0.89
R5283:Ssh1	UTSW	5	113950545	missense	probably damaging	1.00
R5810:Ssh1	UTSW	5	113946566	missense	probably benign	0.05
R5877:Ssh1	UTSW	5	113943120	missense	probably benign	0.29
R6140:Ssh1	UTSW	5	113942631	missense	probably benign	0.16
R6360:Ssh1	UTSW	5	113961347	splice site	probably null
R6612:Ssh1	UTSW	5	113958730	missense	probably benign	0.43
R6819:Ssh1	UTSW	5	113946790	missense	probably benign
R6855:Ssh1	UTSW	5	113942575	missense	probably damaging	1.00
R7389:Ssh1	UTSW	5	113958831	missense	probably benign	0.28
R7470:Ssh1	UTSW	5	113942427	missense	possibly damaging	0.63
R7568:Ssh1	UTSW	5	113957380	splice site	probably null
R7647:Ssh1	UTSW	5	113942958	missense	probably benign	0.00
R7649:Ssh1	UTSW	5	113950551	missense	probably benign	0.12
R7754:Ssh1	UTSW	5	113966234	missense	probably benign	0.31
R7887:Ssh1	UTSW	5	113961349	critical splice donor site	probably null
R8167:Ssh1	UTSW	5	113951990	missense	possibly damaging	0.49
R8289:Ssh1	UTSW	5	113942384	missense	probably benign	0.01
Z1177:Ssh1	UTSW	5	113966294	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- GCTCATTATGAACCCGCAATGCACC -3'
(R):5'- CTGTGTTCCACCAAGAGCCTTGTC -3'

Sequencing Primer
(F):5'- AATGCACCACTTCCCTGG -3'
(R):5'- GCATCTTAAGTTCCTAAGCACTG -3'

Posted On

2013-11-07