Incidental Mutation 'R0939:Ssh1'
ID81295
Institutional Source Beutler Lab
Gene Symbol Ssh1
Ensembl Gene ENSMUSG00000042121
Gene Nameslingshot protein phosphatase 1
SynonymsmSSH-1L, LOC384311
MMRRC Submission 039078-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0939 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location113937094-113993894 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113970436 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 50 (L50P)
Ref Sequence ENSEMBL: ENSMUSP00000124312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077689] [ENSMUST00000112298] [ENSMUST00000159510] [ENSMUST00000159592] [ENSMUST00000162396]
Predicted Effect probably damaging
Transcript: ENSMUST00000077689
AA Change: L7P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076873
Gene: ENSMUSG00000042121
AA Change: L7P

DomainStartEndE-ValueType
Pfam:DEK_C 208 261 1.1e-19 PFAM
DSPc 265 403 7.82e-47 SMART
low complexity region 490 503 N/A INTRINSIC
low complexity region 654 669 N/A INTRINSIC
low complexity region 686 704 N/A INTRINSIC
low complexity region 732 748 N/A INTRINSIC
low complexity region 874 892 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112298
AA Change: L50P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107917
Gene: ENSMUSG00000042121
AA Change: L50P

DomainStartEndE-ValueType
low complexity region 13 22 N/A INTRINSIC
Pfam:DEK_C 229 282 9.5e-20 PFAM
DSPc 286 424 7.82e-47 SMART
low complexity region 511 524 N/A INTRINSIC
low complexity region 675 690 N/A INTRINSIC
low complexity region 707 725 N/A INTRINSIC
low complexity region 753 769 N/A INTRINSIC
low complexity region 895 913 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159510
Predicted Effect probably damaging
Transcript: ENSMUST00000159592
AA Change: L50P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124312
Gene: ENSMUSG00000042121
AA Change: L50P

DomainStartEndE-ValueType
low complexity region 13 22 N/A INTRINSIC
Pfam:DEK_C 252 303 2.3e-17 PFAM
DSPc 308 446 7.82e-47 SMART
low complexity region 533 546 N/A INTRINSIC
low complexity region 697 712 N/A INTRINSIC
low complexity region 729 747 N/A INTRINSIC
low complexity region 775 791 N/A INTRINSIC
low complexity region 917 935 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162322
Predicted Effect probably benign
Transcript: ENSMUST00000162396
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the slingshot homolog (SSH) family of phosphatases, which regulate actin filament dynamics. The SSH proteins dephosphorylate and activate the actin binding/depolymerizing factor cofilin, which subsequently binds to actin filaments and stimulates their disassembly. Cofilin is inactivated by kinases such as LIM domain kinase-1 (LIMK1), which may also be dephosphorylated and inactivated by SSH proteins. The SSH family thus appears to play a role in actin dynamics by reactivating cofilin proteins. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C T 11: 120,012,143 V419M probably damaging Het
Cdcp1 A G 9: 123,183,690 V264A probably damaging Het
Cfap53 A G 18: 74,305,730 D326G probably null Het
Dach1 A G 14: 97,915,924 V436A probably damaging Het
Dnah11 C T 12: 118,060,407 G1870S probably damaging Het
Dst C A 1: 34,244,383 H5324N probably damaging Het
Eapp TTTCTTCTTCTTCTTCTT TTTCTTCTTCTTCTT 12: 54,685,949 probably benign Het
Esd C A 14: 74,736,027 H21N probably damaging Het
Gnmt A G 17: 46,726,345 L171P probably damaging Het
Igdcc4 T A 9: 65,131,473 probably null Het
Mug1 A T 6: 121,884,349 I1310F possibly damaging Het
Mybpc2 T C 7: 44,506,887 K834R probably benign Het
Olfr1013 T A 2: 85,770,653 L284* probably null Het
Olfr1564 T C 17: 33,215,661 K231E possibly damaging Het
Olfr516 T A 7: 108,845,233 Y259F probably damaging Het
Pcdh17 A G 14: 84,447,755 D554G probably damaging Het
Plcxd3 T A 15: 4,516,862 L116* probably null Het
Prss1 A C 6: 41,463,588 D199A probably damaging Het
Rbms3 C T 9: 117,109,960 probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rreb1 A G 13: 37,932,231 M1189V probably benign Het
Slc25a39 T C 11: 102,405,051 E118G probably damaging Het
Slfn5 G T 11: 82,961,338 M763I probably benign Het
Speer4f2 A G 5: 17,374,404 E67G probably damaging Het
Spef2 A T 15: 9,704,550 probably null Het
Spocd1 A T 4: 129,948,870 D26V possibly damaging Het
Tle1 A G 4: 72,118,534 L728P probably damaging Het
Trio A G 15: 27,741,250 probably null Het
Tubb1 G A 2: 174,455,756 E53K probably damaging Het
Vmn2r71 A T 7: 85,623,681 T568S possibly damaging Het
Other mutations in Ssh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Ssh1 APN 5 113942576 missense probably damaging 1.00
IGL01432:Ssh1 APN 5 113958822 missense probably benign 0.31
IGL01933:Ssh1 APN 5 113950380 splice site probably benign
IGL01951:Ssh1 APN 5 113966247 missense possibly damaging 0.64
IGL02117:Ssh1 APN 5 113946480 nonsense probably null
IGL02391:Ssh1 APN 5 113942517 missense probably damaging 1.00
R0110:Ssh1 UTSW 5 113946705 missense probably benign 0.00
R0469:Ssh1 UTSW 5 113946705 missense probably benign 0.00
R0510:Ssh1 UTSW 5 113946705 missense probably benign 0.00
R0682:Ssh1 UTSW 5 113960657 missense probably damaging 1.00
R0863:Ssh1 UTSW 5 113966731 missense probably damaging 1.00
R1539:Ssh1 UTSW 5 113952003 missense probably damaging 1.00
R1716:Ssh1 UTSW 5 113952020 missense possibly damaging 0.80
R1754:Ssh1 UTSW 5 113955845 missense probably damaging 0.99
R1867:Ssh1 UTSW 5 113943451 missense probably damaging 1.00
R2261:Ssh1 UTSW 5 113942703 missense possibly damaging 0.94
R2262:Ssh1 UTSW 5 113942703 missense possibly damaging 0.94
R2497:Ssh1 UTSW 5 113958858 missense probably damaging 1.00
R3774:Ssh1 UTSW 5 113966722 missense probably damaging 1.00
R3922:Ssh1 UTSW 5 113942708 missense possibly damaging 0.52
R5120:Ssh1 UTSW 5 113957398 missense possibly damaging 0.89
R5283:Ssh1 UTSW 5 113950545 missense probably damaging 1.00
R5810:Ssh1 UTSW 5 113946566 missense probably benign 0.05
R5877:Ssh1 UTSW 5 113943120 missense probably benign 0.29
R6140:Ssh1 UTSW 5 113942631 missense probably benign 0.16
R6360:Ssh1 UTSW 5 113961347 splice site probably null
R6612:Ssh1 UTSW 5 113958730 missense probably benign 0.43
R6819:Ssh1 UTSW 5 113946790 missense probably benign
R6855:Ssh1 UTSW 5 113942575 missense probably damaging 1.00
R7389:Ssh1 UTSW 5 113958831 missense probably benign 0.28
R7470:Ssh1 UTSW 5 113942427 missense possibly damaging 0.63
R7568:Ssh1 UTSW 5 113957380 splice site probably null
R7647:Ssh1 UTSW 5 113942958 missense probably benign 0.00
R7649:Ssh1 UTSW 5 113950551 missense probably benign 0.12
R7754:Ssh1 UTSW 5 113966234 missense probably benign 0.31
R7887:Ssh1 UTSW 5 113961349 critical splice donor site probably null
R7970:Ssh1 UTSW 5 113961349 critical splice donor site probably null
Z1177:Ssh1 UTSW 5 113966294 missense not run
Predicted Primers PCR Primer
(F):5'- GCTCATTATGAACCCGCAATGCACC -3'
(R):5'- CTGTGTTCCACCAAGAGCCTTGTC -3'

Sequencing Primer
(F):5'- AATGCACCACTTCCCTGG -3'
(R):5'- GCATCTTAAGTTCCTAAGCACTG -3'
Posted On2013-11-07