Incidental Mutation 'R0939:Prss1'
ID81297
Institutional Source Beutler Lab
Gene Symbol Prss1
Ensembl Gene ENSMUSG00000062751
Gene Nameprotease, serine 1 (trypsin 1)
SynonymsTry-1, PRSS1, Trygn16, Try1
MMRRC Submission 039078-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0939 (G1)
Quality Score216
Status Not validated
Chromosome6
Chromosomal Location41458932-41463786 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 41463588 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 199 (D199A)
Ref Sequence ENSEMBL: ENSMUSP00000031910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031910]
Predicted Effect probably damaging
Transcript: ENSMUST00000031910
AA Change: D199A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031910
Gene: ENSMUSG00000062751
AA Change: D199A

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
Tryp_SPc 23 239 9.87e-106 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C T 11: 120,012,143 V419M probably damaging Het
Cdcp1 A G 9: 123,183,690 V264A probably damaging Het
Cfap53 A G 18: 74,305,730 D326G probably null Het
Dach1 A G 14: 97,915,924 V436A probably damaging Het
Dnah11 C T 12: 118,060,407 G1870S probably damaging Het
Dst C A 1: 34,244,383 H5324N probably damaging Het
Eapp TTTCTTCTTCTTCTTCTT TTTCTTCTTCTTCTT 12: 54,685,949 probably benign Het
Esd C A 14: 74,736,027 H21N probably damaging Het
Gnmt A G 17: 46,726,345 L171P probably damaging Het
Igdcc4 T A 9: 65,131,473 probably null Het
Mug1 A T 6: 121,884,349 I1310F possibly damaging Het
Mybpc2 T C 7: 44,506,887 K834R probably benign Het
Olfr1013 T A 2: 85,770,653 L284* probably null Het
Olfr1564 T C 17: 33,215,661 K231E possibly damaging Het
Olfr516 T A 7: 108,845,233 Y259F probably damaging Het
Pcdh17 A G 14: 84,447,755 D554G probably damaging Het
Plcxd3 T A 15: 4,516,862 L116* probably null Het
Rbms3 C T 9: 117,109,960 probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rreb1 A G 13: 37,932,231 M1189V probably benign Het
Slc25a39 T C 11: 102,405,051 E118G probably damaging Het
Slfn5 G T 11: 82,961,338 M763I probably benign Het
Speer4f2 A G 5: 17,374,404 E67G probably damaging Het
Spef2 A T 15: 9,704,550 probably null Het
Spocd1 A T 4: 129,948,870 D26V possibly damaging Het
Ssh1 A G 5: 113,970,436 L50P probably damaging Het
Tle1 A G 4: 72,118,534 L728P probably damaging Het
Trio A G 15: 27,741,250 probably null Het
Tubb1 G A 2: 174,455,756 E53K probably damaging Het
Vmn2r71 A T 7: 85,623,681 T568S possibly damaging Het
Other mutations in Prss1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Prss1 APN 6 41462711 missense possibly damaging 0.87
IGL00661:Prss1 APN 6 41462619 missense possibly damaging 0.90
IGL01780:Prss1 APN 6 41463205 missense probably damaging 0.96
IGL02350:Prss1 APN 6 41463205 missense probably damaging 0.96
IGL02357:Prss1 APN 6 41463205 missense probably damaging 0.96
R0090:Prss1 UTSW 6 41461232 missense probably benign 0.00
R0137:Prss1 UTSW 6 41462561 missense probably damaging 1.00
R0143:Prss1 UTSW 6 41463588 missense probably damaging 1.00
R0422:Prss1 UTSW 6 41463312 missense probably damaging 1.00
R0792:Prss1 UTSW 6 41458944 start codon destroyed probably null
R2762:Prss1 UTSW 6 41463281 missense possibly damaging 0.93
R2896:Prss1 UTSW 6 41463705 nonsense probably null
R2915:Prss1 UTSW 6 41462611 missense probably benign 0.11
R2959:Prss1 UTSW 6 41463238 missense probably damaging 0.99
R5123:Prss1 UTSW 6 41463197 missense possibly damaging 0.84
R5587:Prss1 UTSW 6 41463265 missense possibly damaging 0.57
R5610:Prss1 UTSW 6 41461213 missense probably benign 0.07
R6521:Prss1 UTSW 6 41463681 missense probably damaging 1.00
R6788:Prss1 UTSW 6 41463720 missense possibly damaging 0.46
R7199:Prss1 UTSW 6 41462756 missense probably damaging 1.00
R7552:Prss1 UTSW 6 41462573 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GCAAGGATTCCTGCCAGGTGATTG -3'
(R):5'- TTACCAGGGGCAGCCTCCCTTC -3'

Sequencing Primer
(F):5'- AGTTGAGCTTCAAAGCCTAGTG -3'
(R):5'- TTCACTTTATTGACAGTGACTGC -3'
Posted On2013-11-07