Incidental Mutation 'R0962:Acaca'
ID 81298
Institutional Source Beutler Lab
Gene Symbol Acaca
Ensembl Gene ENSMUSG00000020532
Gene Name acetyl-Coenzyme A carboxylase alpha
Synonyms Acc1, LOC327983, Acac, acetyl-CoA carboxylase, A530025K05Rik
MMRRC Submission 039091-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0962 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 84020498-84292477 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 84202129 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 196 (A196T)
Ref Sequence ENSEMBL: ENSMUSP00000139378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020843] [ENSMUST00000103201] [ENSMUST00000183887]
AlphaFold Q5SWU9
Predicted Effect probably damaging
Transcript: ENSMUST00000020843
AA Change: A1375T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020843
Gene: ENSMUSG00000020532
AA Change: A1375T

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 116 236 4.7e-33 PFAM
Pfam:CPSase_L_D2 272 472 2.5e-55 PFAM
Pfam:ATP-grasp 280 443 4.3e-7 PFAM
Pfam:ATP-grasp_4 282 442 1.9e-11 PFAM
Pfam:Dala_Dala_lig_C 284 440 5.4e-7 PFAM
Biotin_carb_C 506 613 3.76e-24 SMART
low complexity region 708 725 N/A INTRINSIC
Pfam:Biotin_lipoyl 751 817 9.8e-19 PFAM
Pfam:ACC_central 818 1568 2.1e-288 PFAM
Pfam:Carboxyl_trans 1668 2222 1.6e-185 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103201
AA Change: A1375T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099490
Gene: ENSMUSG00000020532
AA Change: A1375T

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 116 236 6.7e-29 PFAM
Pfam:ATP-grasp_4 239 442 2e-15 PFAM
Pfam:CPSase_L_D2 272 472 3.3e-55 PFAM
Pfam:Dala_Dala_lig_C 279 440 3e-7 PFAM
Pfam:ATP-grasp 281 442 1.1e-6 PFAM
Biotin_carb_C 506 613 3.76e-24 SMART
low complexity region 708 725 N/A INTRINSIC
Pfam:Biotin_lipoyl 751 817 3.7e-18 PFAM
Pfam:ACC_central 818 1568 3.5e-253 PFAM
Pfam:Carboxyl_trans 1668 2222 2.7e-175 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000183887
AA Change: A196T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139378
Gene: ENSMUSG00000020532
AA Change: A196T

DomainStartEndE-ValueType
Pfam:ACC_central 1 228 8.6e-57 PFAM
Meta Mutation Damage Score 0.5257 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 97.9%
  • 20x: 96.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. There are two ACC forms, alpha and beta, encoded by two different genes. ACC-alpha is highly enriched in lipogenic tissues. The enzyme is under long term control at the transcriptional and translational levels and under short term regulation by the phosphorylation/dephosphorylation of targeted serine residues and by allosteric transformation by citrate or palmitoyl-CoA. Multiple alternatively spliced transcript variants divergent in the 5' sequence and encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality before embryo turning with growth arrest at the egg cylinder stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl4 T A 3: 95,591,798 (GRCm39) R97* probably null Het
Adgrv1 T C 13: 81,553,465 (GRCm39) I5470V probably benign Het
Afg3l2 T C 18: 67,538,497 (GRCm39) T754A possibly damaging Het
Agfg1 T C 1: 82,864,117 (GRCm39) F395S probably damaging Het
Ahnak A G 19: 8,990,212 (GRCm39) probably benign Het
Alkbh2 T C 5: 114,262,014 (GRCm39) K239E possibly damaging Het
Ankmy1 A T 1: 92,827,290 (GRCm39) C87* probably null Het
Apob A G 12: 8,039,191 (GRCm39) I461V probably damaging Het
Arap1 C T 7: 101,034,121 (GRCm39) P188S possibly damaging Het
Atp12a G A 14: 56,605,870 (GRCm39) E64K probably damaging Het
Brca1 A T 11: 101,416,192 (GRCm39) H647Q possibly damaging Het
Cachd1 A G 4: 100,840,498 (GRCm39) probably benign Het
Cep57 A T 9: 13,720,039 (GRCm39) V429D possibly damaging Het
Cfap299 T C 5: 98,714,420 (GRCm39) probably benign Het
Dip2a T C 10: 76,128,266 (GRCm39) probably benign Het
Dmxl2 A T 9: 54,353,696 (GRCm39) N757K probably damaging Het
Dock7 G A 4: 98,833,432 (GRCm39) T1953I possibly damaging Het
Ebf3 T C 7: 136,826,932 (GRCm39) T111A probably damaging Het
Ercc4 T C 16: 12,948,010 (GRCm39) I319T probably damaging Het
Fat1 T C 8: 45,486,363 (GRCm39) probably benign Het
Gucy2g C T 19: 55,198,716 (GRCm39) W809* probably null Het
Hhipl1 A G 12: 108,293,980 (GRCm39) K629E probably benign Het
Hmbox1 A T 14: 65,134,223 (GRCm39) S126T probably benign Het
Htr1a A G 13: 105,580,832 (GRCm39) N24S probably benign Het
Htra3 T A 5: 35,825,700 (GRCm39) I185F probably damaging Het
Impg1 C T 9: 80,289,023 (GRCm39) D345N probably benign Het
Iqca1 C A 1: 90,070,453 (GRCm39) G133V probably null Het
Kdm7a A G 6: 39,124,128 (GRCm39) V720A probably benign Het
Kirrel3 A G 9: 34,912,293 (GRCm39) D212G possibly damaging Het
Lgals3bp A T 11: 118,283,846 (GRCm39) *139K probably null Het
Lrp11 T A 10: 7,466,060 (GRCm39) V82D probably benign Het
Mcf2l T C 8: 13,051,964 (GRCm39) Y425H probably benign Het
Mfn2 T C 4: 147,966,658 (GRCm39) N511S probably benign Het
Mical2 T C 7: 111,979,624 (GRCm39) S108P probably damaging Het
Ms4a6c C T 19: 11,448,506 (GRCm39) T13M probably benign Het
Naip2 C A 13: 100,315,893 (GRCm39) V296F probably damaging Het
Or2d36 T A 7: 106,747,294 (GRCm39) F257Y possibly damaging Het
Or51a5 A G 7: 102,771,217 (GRCm39) V254A possibly damaging Het
Or7e175 T A 9: 20,048,834 (GRCm39) C141S probably damaging Het
P3h2 T C 16: 25,815,998 (GRCm39) M172V probably benign Het
Pcolce2 T G 9: 95,552,087 (GRCm39) N73K probably benign Het
Pla2g4d A G 2: 120,111,098 (GRCm39) probably null Het
Ppfia3 A G 7: 44,997,146 (GRCm39) probably benign Het
Ptprcap A G 19: 4,206,463 (GRCm39) D182G possibly damaging Het
Rabgap1 T C 2: 37,450,481 (GRCm39) probably benign Het
Rpain G A 11: 70,865,867 (GRCm39) probably null Het
Sdk1 C T 5: 142,147,630 (GRCm39) T1754I probably damaging Het
Stag1 T A 9: 100,678,880 (GRCm39) L267Q probably damaging Het
Tex9 T C 9: 72,391,374 (GRCm39) T92A probably benign Het
Trpa1 T A 1: 14,968,387 (GRCm39) I460F possibly damaging Het
Ttn A T 2: 76,780,500 (GRCm39) Y1084N probably damaging Het
Utp6 A G 11: 79,832,694 (GRCm39) probably benign Het
Zbtb39 C G 10: 127,578,175 (GRCm39) Q250E probably benign Het
Other mutations in Acaca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Acaca APN 11 84,169,743 (GRCm39) missense probably damaging 1.00
IGL01134:Acaca APN 11 84,142,105 (GRCm39) missense probably benign 0.22
IGL01446:Acaca APN 11 84,151,457 (GRCm39) missense probably damaging 1.00
IGL01591:Acaca APN 11 84,134,146 (GRCm39) missense probably damaging 1.00
IGL01663:Acaca APN 11 84,168,628 (GRCm39) missense possibly damaging 0.85
IGL01767:Acaca APN 11 84,211,368 (GRCm39) missense probably benign 0.01
IGL02206:Acaca APN 11 84,151,573 (GRCm39) nonsense probably null
IGL02335:Acaca APN 11 84,105,084 (GRCm39) missense possibly damaging 0.84
IGL02477:Acaca APN 11 84,197,994 (GRCm39) splice site probably benign
IGL02515:Acaca APN 11 84,153,229 (GRCm39) missense probably benign
IGL02651:Acaca APN 11 84,136,030 (GRCm39) splice site probably benign
IGL02805:Acaca APN 11 84,113,959 (GRCm39) splice site probably benign
IGL03328:Acaca APN 11 84,211,355 (GRCm39) missense probably benign 0.00
effervescence UTSW 11 84,153,300 (GRCm39) missense probably benign 0.41
fizz UTSW 11 84,136,682 (GRCm39) missense probably damaging 0.98
greenhouse UTSW 11 84,229,182 (GRCm39) missense probably damaging 1.00
Serene UTSW 11 84,202,235 (GRCm39) splice site probably null
Tranquil UTSW 11 84,171,287 (GRCm39) missense probably damaging 1.00
vitamin UTSW 11 84,171,261 (GRCm39) missense possibly damaging 0.78
ANU05:Acaca UTSW 11 84,206,678 (GRCm39) missense probably damaging 1.00
R0385:Acaca UTSW 11 84,122,574 (GRCm39) missense probably benign 0.01
R0518:Acaca UTSW 11 84,181,112 (GRCm39) critical splice acceptor site probably null
R0536:Acaca UTSW 11 84,171,342 (GRCm39) splice site probably benign
R0968:Acaca UTSW 11 84,129,859 (GRCm39) nonsense probably null
R1123:Acaca UTSW 11 84,154,906 (GRCm39) missense probably benign 0.09
R1452:Acaca UTSW 11 84,185,885 (GRCm39) splice site probably benign
R1478:Acaca UTSW 11 84,263,453 (GRCm39) missense probably damaging 1.00
R1500:Acaca UTSW 11 84,184,810 (GRCm39) missense probably benign 0.00
R1512:Acaca UTSW 11 84,086,295 (GRCm39) missense probably benign 0.00
R1657:Acaca UTSW 11 84,154,910 (GRCm39) missense probably benign 0.09
R1681:Acaca UTSW 11 84,117,011 (GRCm39) missense probably damaging 1.00
R1682:Acaca UTSW 11 84,283,043 (GRCm39) missense probably benign 0.23
R1688:Acaca UTSW 11 84,129,722 (GRCm39) missense probably damaging 1.00
R1755:Acaca UTSW 11 84,167,390 (GRCm39) frame shift probably null
R1775:Acaca UTSW 11 84,191,248 (GRCm39) missense possibly damaging 0.56
R1793:Acaca UTSW 11 84,229,219 (GRCm39) missense probably damaging 1.00
R1793:Acaca UTSW 11 84,206,795 (GRCm39) missense probably damaging 0.98
R1855:Acaca UTSW 11 84,262,380 (GRCm39) missense probably damaging 0.96
R1881:Acaca UTSW 11 84,191,297 (GRCm39) splice site probably benign
R1881:Acaca UTSW 11 84,161,213 (GRCm39) nonsense probably null
R1989:Acaca UTSW 11 84,153,355 (GRCm39) missense probably damaging 0.98
R2147:Acaca UTSW 11 84,167,362 (GRCm39) missense probably benign 0.03
R2215:Acaca UTSW 11 84,254,619 (GRCm39) missense probably damaging 1.00
R2238:Acaca UTSW 11 84,282,331 (GRCm39) splice site probably benign
R2252:Acaca UTSW 11 84,262,358 (GRCm39) missense probably damaging 0.99
R2316:Acaca UTSW 11 84,185,809 (GRCm39) missense possibly damaging 0.69
R2316:Acaca UTSW 11 84,154,906 (GRCm39) missense probably benign 0.16
R2337:Acaca UTSW 11 84,148,023 (GRCm39) missense possibly damaging 0.93
R2697:Acaca UTSW 11 84,255,239 (GRCm39) missense probably damaging 1.00
R3551:Acaca UTSW 11 84,152,450 (GRCm39) missense probably damaging 1.00
R3552:Acaca UTSW 11 84,152,450 (GRCm39) missense probably damaging 1.00
R3748:Acaca UTSW 11 84,202,235 (GRCm39) splice site probably null
R3844:Acaca UTSW 11 84,255,239 (GRCm39) missense probably damaging 1.00
R3873:Acaca UTSW 11 84,203,547 (GRCm39) unclassified probably benign
R4152:Acaca UTSW 11 84,183,752 (GRCm39) missense possibly damaging 0.88
R4406:Acaca UTSW 11 84,171,275 (GRCm39) missense probably benign 0.35
R4448:Acaca UTSW 11 84,153,318 (GRCm39) missense probably damaging 1.00
R4642:Acaca UTSW 11 84,171,287 (GRCm39) missense probably damaging 1.00
R4696:Acaca UTSW 11 84,171,261 (GRCm39) missense possibly damaging 0.78
R4707:Acaca UTSW 11 84,203,680 (GRCm39) missense probably damaging 0.96
R4710:Acaca UTSW 11 84,283,163 (GRCm39) missense possibly damaging 0.84
R4775:Acaca UTSW 11 84,134,165 (GRCm39) missense probably damaging 1.00
R4821:Acaca UTSW 11 84,185,813 (GRCm39) missense possibly damaging 0.69
R4883:Acaca UTSW 11 84,142,116 (GRCm39) missense probably benign 0.01
R4988:Acaca UTSW 11 84,154,121 (GRCm39) missense probably damaging 1.00
R5034:Acaca UTSW 11 84,136,090 (GRCm39) missense probably benign 0.00
R5255:Acaca UTSW 11 84,202,133 (GRCm39) missense probably damaging 1.00
R5294:Acaca UTSW 11 84,282,345 (GRCm39) missense probably benign 0.01
R5350:Acaca UTSW 11 84,106,699 (GRCm39) missense probably damaging 0.99
R5437:Acaca UTSW 11 84,237,646 (GRCm39) splice site probably null
R5664:Acaca UTSW 11 84,134,210 (GRCm39) missense probably damaging 1.00
R5665:Acaca UTSW 11 84,136,120 (GRCm39) nonsense probably null
R5959:Acaca UTSW 11 84,106,792 (GRCm39) missense probably damaging 1.00
R6011:Acaca UTSW 11 84,136,570 (GRCm39) missense probably benign 0.44
R6027:Acaca UTSW 11 84,289,003 (GRCm39) missense probably benign
R6246:Acaca UTSW 11 84,206,796 (GRCm39) missense probably benign 0.08
R6313:Acaca UTSW 11 84,183,755 (GRCm39) missense probably benign 0.00
R6450:Acaca UTSW 11 84,171,294 (GRCm39) missense probably damaging 0.98
R6623:Acaca UTSW 11 84,262,325 (GRCm39) critical splice acceptor site probably null
R6736:Acaca UTSW 11 84,129,664 (GRCm39) missense probably benign 0.05
R6752:Acaca UTSW 11 84,086,309 (GRCm39) missense probably benign 0.44
R6807:Acaca UTSW 11 84,282,356 (GRCm39) missense probably benign
R6826:Acaca UTSW 11 84,086,362 (GRCm39) missense probably damaging 1.00
R7035:Acaca UTSW 11 84,129,769 (GRCm39) missense probably damaging 1.00
R7078:Acaca UTSW 11 84,154,138 (GRCm39) missense possibly damaging 0.91
R7088:Acaca UTSW 11 84,169,783 (GRCm39) critical splice donor site probably null
R7201:Acaca UTSW 11 84,153,300 (GRCm39) missense probably benign 0.41
R7261:Acaca UTSW 11 84,259,526 (GRCm39) missense probably damaging 1.00
R7399:Acaca UTSW 11 84,151,505 (GRCm39) missense possibly damaging 0.89
R7421:Acaca UTSW 11 84,254,562 (GRCm39) missense possibly damaging 0.64
R7443:Acaca UTSW 11 84,206,619 (GRCm39) missense probably benign 0.02
R7453:Acaca UTSW 11 84,136,136 (GRCm39) missense probably benign
R7471:Acaca UTSW 11 84,168,608 (GRCm39) splice site probably null
R7519:Acaca UTSW 11 84,136,682 (GRCm39) missense probably damaging 0.98
R7537:Acaca UTSW 11 84,151,460 (GRCm39) missense probably damaging 1.00
R7574:Acaca UTSW 11 84,152,414 (GRCm39) missense probably benign
R7633:Acaca UTSW 11 84,263,465 (GRCm39) missense probably benign 0.26
R7643:Acaca UTSW 11 84,229,182 (GRCm39) missense probably damaging 1.00
R7664:Acaca UTSW 11 84,136,175 (GRCm39) missense probably damaging 1.00
R7675:Acaca UTSW 11 84,206,742 (GRCm39) missense probably benign 0.04
R7676:Acaca UTSW 11 84,185,813 (GRCm39) missense possibly damaging 0.69
R7729:Acaca UTSW 11 84,262,339 (GRCm39) missense probably damaging 0.98
R7867:Acaca UTSW 11 84,140,350 (GRCm39) missense possibly damaging 0.88
R7898:Acaca UTSW 11 84,255,275 (GRCm39) critical splice donor site probably null
R7909:Acaca UTSW 11 84,136,061 (GRCm39) missense possibly damaging 0.56
R7915:Acaca UTSW 11 84,167,414 (GRCm39) missense probably benign
R7956:Acaca UTSW 11 84,211,406 (GRCm39) missense probably damaging 0.98
R8000:Acaca UTSW 11 84,283,057 (GRCm39) missense possibly damaging 0.88
R8038:Acaca UTSW 11 84,106,730 (GRCm39) missense probably damaging 1.00
R8545:Acaca UTSW 11 84,236,794 (GRCm39) missense probably damaging 1.00
R8722:Acaca UTSW 11 84,229,283 (GRCm39) missense possibly damaging 0.85
R9005:Acaca UTSW 11 84,262,410 (GRCm39) missense probably damaging 0.99
R9130:Acaca UTSW 11 84,202,145 (GRCm39) missense probably damaging 1.00
R9397:Acaca UTSW 11 84,259,551 (GRCm39) missense probably damaging 1.00
R9489:Acaca UTSW 11 84,183,842 (GRCm39) missense probably benign 0.01
R9540:Acaca UTSW 11 84,134,237 (GRCm39) missense probably damaging 1.00
R9593:Acaca UTSW 11 84,271,339 (GRCm39) nonsense probably null
R9605:Acaca UTSW 11 84,183,842 (GRCm39) missense probably benign 0.01
R9634:Acaca UTSW 11 84,184,816 (GRCm39) missense probably benign 0.00
R9720:Acaca UTSW 11 84,154,183 (GRCm39) missense probably damaging 1.00
RF014:Acaca UTSW 11 84,122,550 (GRCm39) missense probably benign 0.01
X0027:Acaca UTSW 11 84,183,721 (GRCm39) missense probably benign 0.01
X0060:Acaca UTSW 11 84,154,930 (GRCm39) missense probably benign
X0067:Acaca UTSW 11 84,259,563 (GRCm39) nonsense probably null
Z1176:Acaca UTSW 11 84,151,546 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACTCACAGCACTGTCATGCAAAG -3'
(R):5'- TCGCACGAACAAAGAACCTGTAGTC -3'

Sequencing Primer
(F):5'- ctccctctctctctctctctc -3'
(R):5'- AGAACCTGTAGTCAGTCACTTCTG -3'
Posted On 2013-11-07