Incidental Mutation 'R0962:Brca1'
ID81300
Institutional Source Beutler Lab
Gene Symbol Brca1
Ensembl Gene ENSMUSG00000017146
Gene Namebreast cancer 1, early onset
Synonyms
MMRRC Submission 039091-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0962 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location101488764-101551955 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 101525366 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 647 (H647Q)
Ref Sequence ENSEMBL: ENSMUSP00000017290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017290] [ENSMUST00000142086] [ENSMUST00000191198]
Predicted Effect possibly damaging
Transcript: ENSMUST00000017290
AA Change: H647Q

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000017290
Gene: ENSMUSG00000017146
AA Change: H647Q

DomainStartEndE-ValueType
RING 24 64 1.82e-7 SMART
Pfam:BRCT_assoc 342 503 2.6e-69 PFAM
low complexity region 1173 1185 N/A INTRINSIC
Blast:BRCT 1343 1406 2e-16 BLAST
low complexity region 1555 1575 N/A INTRINSIC
BRCT 1587 1669 3.87e-11 SMART
BRCT 1700 1787 3.42e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131460
Predicted Effect probably benign
Transcript: ENSMUST00000142086
SMART Domains Protein: ENSMUSP00000139813
Gene: ENSMUSG00000017146

DomainStartEndE-ValueType
RING 24 64 8.6e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188168
Predicted Effect probably benign
Transcript: ENSMUST00000191198
SMART Domains Protein: ENSMUSP00000139737
Gene: ENSMUSG00000017146

DomainStartEndE-ValueType
Pfam:EIN3 1 146 3.5e-18 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 97.9%
  • 20x: 96.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA1 protein survive, have a kinky tail, pigmentation anomalies, male infertility and increased tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik T C 5: 98,566,561 probably benign Het
Acaca G A 11: 84,311,303 A196T probably damaging Het
Adamtsl4 T A 3: 95,684,488 R97* probably null Het
Adgrv1 T C 13: 81,405,346 I5470V probably benign Het
Afg3l2 T C 18: 67,405,427 T754A possibly damaging Het
Agfg1 T C 1: 82,886,396 F395S probably damaging Het
Ahnak A G 19: 9,012,848 probably benign Het
Alkbh2 T C 5: 114,123,953 K239E possibly damaging Het
Ankmy1 A T 1: 92,899,568 C87* probably null Het
Apob A G 12: 7,989,191 I461V probably damaging Het
Arap1 C T 7: 101,384,914 P188S possibly damaging Het
Atp12a G A 14: 56,368,413 E64K probably damaging Het
Cachd1 A G 4: 100,983,301 probably benign Het
Cep57 A T 9: 13,808,743 V429D possibly damaging Het
Dip2a T C 10: 76,292,432 probably benign Het
Dmxl2 A T 9: 54,446,412 N757K probably damaging Het
Dock7 G A 4: 98,945,195 T1953I possibly damaging Het
Ebf3 T C 7: 137,225,203 T111A probably damaging Het
Ercc4 T C 16: 13,130,146 I319T probably damaging Het
Fat1 T C 8: 45,033,326 probably benign Het
Gucy2g C T 19: 55,210,284 W809* probably null Het
Hhipl1 A G 12: 108,327,721 K629E probably benign Het
Hmbox1 A T 14: 64,896,774 S126T probably benign Het
Htr1a A G 13: 105,444,324 N24S probably benign Het
Htra3 T A 5: 35,668,356 I185F probably damaging Het
Impg1 C T 9: 80,381,741 D345N probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kdm7a A G 6: 39,147,194 V720A probably benign Het
Kirrel3 A G 9: 35,000,997 D212G possibly damaging Het
Lgals3bp A T 11: 118,393,020 *139K probably null Het
Lrp11 T A 10: 7,590,296 V82D probably benign Het
Mcf2l T C 8: 13,001,964 Y425H probably benign Het
Mfn2 T C 4: 147,882,201 N511S probably benign Het
Micalcl T C 7: 112,380,417 S108P probably damaging Het
Ms4a6c C T 19: 11,471,142 T13M probably benign Het
Naip2 C A 13: 100,179,385 V296F probably damaging Het
Olfr586 A G 7: 103,122,010 V254A possibly damaging Het
Olfr716 T A 7: 107,148,087 F257Y possibly damaging Het
Olfr869 T A 9: 20,137,538 C141S probably damaging Het
P3h2 T C 16: 25,997,248 M172V probably benign Het
Pcolce2 T G 9: 95,670,034 N73K probably benign Het
Pla2g4d A G 2: 120,280,617 probably null Het
Ppfia3 A G 7: 45,347,722 probably benign Het
Ptprcap A G 19: 4,156,464 D182G possibly damaging Het
Rabgap1 T C 2: 37,560,469 probably benign Het
Rpain G A 11: 70,975,041 probably null Het
Sdk1 C T 5: 142,161,875 T1754I probably damaging Het
Stag1 T A 9: 100,796,827 L267Q probably damaging Het
Tex9 T C 9: 72,484,092 T92A probably benign Het
Trpa1 T A 1: 14,898,163 I460F possibly damaging Het
Ttn A T 2: 76,950,156 Y1084N probably damaging Het
Utp6 A G 11: 79,941,868 probably benign Het
Zbtb39 C G 10: 127,742,306 Q250E probably benign Het
Other mutations in Brca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Brca1 APN 11 101524369 missense possibly damaging 0.71
IGL01598:Brca1 APN 11 101524330 missense probably benign 0.04
IGL01744:Brca1 APN 11 101524176 missense possibly damaging 0.73
IGL02128:Brca1 APN 11 101530982 unclassified probably benign
IGL02377:Brca1 APN 11 101524323 missense probably benign 0.01
IGL02701:Brca1 APN 11 101525235 missense probably damaging 1.00
IGL02732:Brca1 APN 11 101492219 missense probably benign 0.07
IGL02935:Brca1 APN 11 101489867 missense probably benign 0.00
IGL02940:Brca1 APN 11 101489912 missense probably benign 0.00
IGL03198:Brca1 APN 11 101512711 splice site probably benign
PIT4142001:Brca1 UTSW 11 101522422 unclassified probably benign
R0048:Brca1 UTSW 11 101524977 missense possibly damaging 0.94
R0048:Brca1 UTSW 11 101524977 missense possibly damaging 0.94
R0109:Brca1 UTSW 11 101531090 missense possibly damaging 0.85
R0109:Brca1 UTSW 11 101531090 missense possibly damaging 0.85
R0144:Brca1 UTSW 11 101526121 missense probably damaging 1.00
R0336:Brca1 UTSW 11 101523993 missense probably benign 0.04
R0448:Brca1 UTSW 11 101508221 missense possibly damaging 0.93
R0595:Brca1 UTSW 11 101524887 missense probably benign 0.27
R0613:Brca1 UTSW 11 101508210 missense probably benign 0.18
R0863:Brca1 UTSW 11 101524770 missense probably benign 0.36
R0940:Brca1 UTSW 11 101532143 missense possibly damaging 0.73
R1365:Brca1 UTSW 11 101501996 missense probably benign
R1391:Brca1 UTSW 11 101526546 missense possibly damaging 0.53
R1467:Brca1 UTSW 11 101531107 unclassified probably benign
R1484:Brca1 UTSW 11 101529812 missense possibly damaging 0.86
R1530:Brca1 UTSW 11 101524695 missense probably damaging 1.00
R1645:Brca1 UTSW 11 101510053 missense probably benign 0.00
R1682:Brca1 UTSW 11 101525565 missense probably damaging 0.98
R1687:Brca1 UTSW 11 101489840 missense probably benign
R1694:Brca1 UTSW 11 101532099 missense probably damaging 0.98
R1695:Brca1 UTSW 11 101524455 missense probably damaging 0.97
R1762:Brca1 UTSW 11 101532018 critical splice donor site probably null
R1868:Brca1 UTSW 11 101498013 missense probably benign
R1973:Brca1 UTSW 11 101526403 missense probably benign 0.22
R2034:Brca1 UTSW 11 101489849 missense probably benign
R2106:Brca1 UTSW 11 101524977 missense possibly damaging 0.94
R4089:Brca1 UTSW 11 101524176 missense possibly damaging 0.73
R4194:Brca1 UTSW 11 101525287 missense probably benign 0.02
R4571:Brca1 UTSW 11 101517366 missense probably benign 0.00
R4735:Brca1 UTSW 11 101492175 splice site probably null
R4789:Brca1 UTSW 11 101523932 missense probably benign 0.00
R4920:Brca1 UTSW 11 101524959 missense probably damaging 1.00
R4939:Brca1 UTSW 11 101508050 missense probably benign
R4997:Brca1 UTSW 11 101524333 missense probably damaging 0.96
R5458:Brca1 UTSW 11 101517285 missense possibly damaging 0.53
R5778:Brca1 UTSW 11 101525301 missense possibly damaging 0.47
R6051:Brca1 UTSW 11 101524246 missense probably damaging 1.00
R6505:Brca1 UTSW 11 101523541 missense probably benign 0.03
R6548:Brca1 UTSW 11 101524765 missense probably damaging 1.00
R6971:Brca1 UTSW 11 101534005 missense probably benign 0.18
R7091:Brca1 UTSW 11 101526427 missense probably benign 0.00
R7246:Brca1 UTSW 11 101523378 missense probably benign 0.00
R7417:Brca1 UTSW 11 101524981 missense probably damaging 1.00
R7861:Brca1 UTSW 11 101526422 missense possibly damaging 0.87
R7944:Brca1 UTSW 11 101526422 missense possibly damaging 0.87
R8003:Brca1 UTSW 11 101524477 missense probably benign 0.22
R8046:Brca1 UTSW 11 101525470 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGCATATCTGACAGTGTGAGCGTCC -3'
(R):5'- TGCTTCCACAGCAGGAGCCAAATC -3'

Sequencing Primer
(F):5'- TCGTAGTCAGTGTCAGATACCAAG -3'
(R):5'- GATTTGGAGGTAGAATTAAACGTCC -3'
Posted On2013-11-07