Incidental Mutation 'R0962:Htr1a'
ID81312
Institutional Source Beutler Lab
Gene Symbol Htr1a
Ensembl Gene ENSMUSG00000021721
Gene Name5-hydroxytryptamine (serotonin) receptor 1A
Synonyms5-HT1A receptor, Gpcr18
MMRRC Submission 039091-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0962 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location105443639-105448122 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105444324 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 24 (N24S)
Ref Sequence ENSEMBL: ENSMUSP00000022235 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022235]
Predicted Effect probably benign
Transcript: ENSMUST00000022235
AA Change: N24S

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000022235
Gene: ENSMUSG00000021721
AA Change: N24S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 45 174 2.7e-5 PFAM
Pfam:7TM_GPCR_Srsx 47 236 8e-8 PFAM
Pfam:7tm_1 53 400 1.3e-88 PFAM
Meta Mutation Damage Score 0.1363 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 97.9%
  • 20x: 96.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G protein-coupled receptor for 5-hydroxytryptamine (serotonin), and belongs to the 5-hydroxytryptamine receptor subfamily. Serotonin has been implicated in a number of physiologic processes and pathologic conditions. Inactivation of this gene in mice results in behavior consistent with an increased anxiety and stress response. Mutation in the promoter of this gene has been associated with menstrual cycle-dependent periodic fevers. [provided by RefSeq, Jun 2012]
PHENOTYPE: Homozygotes for targeted null mutations show a common phenotype, including augmented anxious-like behavior in the elevated plus-maze, open-field, and novel object tests, reduced immobility in the forced-swim or tail-suspension test, and changes in density of 5-HTT binding in several brain regions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik T C 5: 98,566,561 probably benign Het
Acaca G A 11: 84,311,303 A196T probably damaging Het
Adamtsl4 T A 3: 95,684,488 R97* probably null Het
Adgrv1 T C 13: 81,405,346 I5470V probably benign Het
Afg3l2 T C 18: 67,405,427 T754A possibly damaging Het
Agfg1 T C 1: 82,886,396 F395S probably damaging Het
Ahnak A G 19: 9,012,848 probably benign Het
Alkbh2 T C 5: 114,123,953 K239E possibly damaging Het
Ankmy1 A T 1: 92,899,568 C87* probably null Het
Apob A G 12: 7,989,191 I461V probably damaging Het
Arap1 C T 7: 101,384,914 P188S possibly damaging Het
Atp12a G A 14: 56,368,413 E64K probably damaging Het
Brca1 A T 11: 101,525,366 H647Q possibly damaging Het
Cachd1 A G 4: 100,983,301 probably benign Het
Cep57 A T 9: 13,808,743 V429D possibly damaging Het
Dip2a T C 10: 76,292,432 probably benign Het
Dmxl2 A T 9: 54,446,412 N757K probably damaging Het
Dock7 G A 4: 98,945,195 T1953I possibly damaging Het
Ebf3 T C 7: 137,225,203 T111A probably damaging Het
Ercc4 T C 16: 13,130,146 I319T probably damaging Het
Fat1 T C 8: 45,033,326 probably benign Het
Gucy2g C T 19: 55,210,284 W809* probably null Het
Hhipl1 A G 12: 108,327,721 K629E probably benign Het
Hmbox1 A T 14: 64,896,774 S126T probably benign Het
Htra3 T A 5: 35,668,356 I185F probably damaging Het
Impg1 C T 9: 80,381,741 D345N probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kdm7a A G 6: 39,147,194 V720A probably benign Het
Kirrel3 A G 9: 35,000,997 D212G possibly damaging Het
Lgals3bp A T 11: 118,393,020 *139K probably null Het
Lrp11 T A 10: 7,590,296 V82D probably benign Het
Mcf2l T C 8: 13,001,964 Y425H probably benign Het
Mfn2 T C 4: 147,882,201 N511S probably benign Het
Micalcl T C 7: 112,380,417 S108P probably damaging Het
Ms4a6c C T 19: 11,471,142 T13M probably benign Het
Naip2 C A 13: 100,179,385 V296F probably damaging Het
Olfr586 A G 7: 103,122,010 V254A possibly damaging Het
Olfr716 T A 7: 107,148,087 F257Y possibly damaging Het
Olfr869 T A 9: 20,137,538 C141S probably damaging Het
P3h2 T C 16: 25,997,248 M172V probably benign Het
Pcolce2 T G 9: 95,670,034 N73K probably benign Het
Pla2g4d A G 2: 120,280,617 probably null Het
Ppfia3 A G 7: 45,347,722 probably benign Het
Ptprcap A G 19: 4,156,464 D182G possibly damaging Het
Rabgap1 T C 2: 37,560,469 probably benign Het
Rpain G A 11: 70,975,041 probably null Het
Sdk1 C T 5: 142,161,875 T1754I probably damaging Het
Stag1 T A 9: 100,796,827 L267Q probably damaging Het
Tex9 T C 9: 72,484,092 T92A probably benign Het
Trpa1 T A 1: 14,898,163 I460F possibly damaging Het
Ttn A T 2: 76,950,156 Y1084N probably damaging Het
Utp6 A G 11: 79,941,868 probably benign Het
Zbtb39 C G 10: 127,742,306 Q250E probably benign Het
Other mutations in Htr1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:Htr1a APN 13 105445284 missense possibly damaging 0.88
R0578:Htr1a UTSW 13 105445087 missense probably damaging 1.00
R0919:Htr1a UTSW 13 105444836 missense probably damaging 1.00
R1143:Htr1a UTSW 13 105445068 missense probably benign
R1349:Htr1a UTSW 13 105445366 nonsense probably null
R1550:Htr1a UTSW 13 105445280 missense probably benign 0.09
R2520:Htr1a UTSW 13 105445373 missense probably benign 0.43
R3794:Htr1a UTSW 13 105444344 missense possibly damaging 0.59
R6679:Htr1a UTSW 13 105445428 missense probably damaging 1.00
R6844:Htr1a UTSW 13 105444947 missense possibly damaging 0.94
R7680:Htr1a UTSW 13 105445031 missense probably benign
Z1177:Htr1a UTSW 13 105444876 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGTAAGAACTTCCCGCTCCAGTC -3'
(R):5'- ACCCAGAGTCCACTTGTTGAGCAC -3'

Sequencing Primer
(F):5'- TAGATCCCCTCCCTTCGAAAC -3'
(R):5'- CTGACACCATGAGATCGGTGAC -3'
Posted On2013-11-07