Incidental Mutation 'R0939:Rbms3'
ID81313
Institutional Source Beutler Lab
Gene Symbol Rbms3
Ensembl Gene ENSMUSG00000039607
Gene NameRNA binding motif, single stranded interacting protein
Synonyms
MMRRC Submission 039078-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R0939 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location116572746-117629913 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 117109960 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044901] [ENSMUST00000068962] [ENSMUST00000111772] [ENSMUST00000111773] [ENSMUST00000164018] [ENSMUST00000172564] [ENSMUST00000172564] [ENSMUST00000174868]
Predicted Effect probably null
Transcript: ENSMUST00000044901
SMART Domains Protein: ENSMUSP00000039706
Gene: ENSMUSG00000039607

DomainStartEndE-ValueType
low complexity region 27 49 N/A INTRINSIC
RRM 57 125 1.2e-17 SMART
RRM 136 208 1.49e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000068962
SMART Domains Protein: ENSMUSP00000066735
Gene: ENSMUSG00000039607

DomainStartEndE-ValueType
low complexity region 27 49 N/A INTRINSIC
RRM 57 125 1.2e-17 SMART
RRM 136 208 1.49e-13 SMART
low complexity region 384 394 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000069095
Predicted Effect noncoding transcript
Transcript: ENSMUST00000084824
Predicted Effect probably null
Transcript: ENSMUST00000111772
SMART Domains Protein: ENSMUSP00000107402
Gene: ENSMUSG00000039607

DomainStartEndE-ValueType
low complexity region 27 49 N/A INTRINSIC
RRM 57 125 1.2e-17 SMART
RRM 136 208 1.49e-13 SMART
low complexity region 385 395 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111773
SMART Domains Protein: ENSMUSP00000107403
Gene: ENSMUSG00000039607

DomainStartEndE-ValueType
low complexity region 27 49 N/A INTRINSIC
RRM 57 125 1.2e-17 SMART
RRM 136 208 1.49e-13 SMART
low complexity region 401 411 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000164018
SMART Domains Protein: ENSMUSP00000131371
Gene: ENSMUSG00000039607

DomainStartEndE-ValueType
low complexity region 76 98 N/A INTRINSIC
RRM 106 174 1.2e-17 SMART
RRM 185 257 1.49e-13 SMART
low complexity region 433 443 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000172564
SMART Domains Protein: ENSMUSP00000134528
Gene: ENSMUSG00000039607

DomainStartEndE-ValueType
low complexity region 26 48 N/A INTRINSIC
RRM 56 124 1.2e-17 SMART
RRM 135 204 4.78e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000172564
SMART Domains Protein: ENSMUSP00000134528
Gene: ENSMUSG00000039607

DomainStartEndE-ValueType
low complexity region 26 48 N/A INTRINSIC
RRM 56 124 1.2e-17 SMART
RRM 135 204 4.78e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174276
Predicted Effect probably null
Transcript: ENSMUST00000174868
SMART Domains Protein: ENSMUSP00000133621
Gene: ENSMUSG00000039607

DomainStartEndE-ValueType
low complexity region 27 49 N/A INTRINSIC
RRM 57 125 1.2e-17 SMART
RRM 136 208 1.49e-13 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein that belongs to the c-myc gene single-strand binding protein family. These proteins are characterized by the presence of two sets of ribonucleoprotein consensus sequence (RNP-CS) that contain conserved motifs, RNP1 and RNP2, originally described in RNA binding proteins, and required for DNA binding. These proteins have been implicated in such diverse functions as DNA replication, gene transcription, cell cycle progression and apoptosis. The encoded protein was isolated by virtue of its binding to an upstream element of the alpha2(I) collagen promoter. The observation that this protein localizes mostly in the cytoplasm suggests that it may be involved in a cytoplasmic function such as controlling RNA metabolism, rather than transcription. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C T 11: 120,012,143 V419M probably damaging Het
Cdcp1 A G 9: 123,183,690 V264A probably damaging Het
Cfap53 A G 18: 74,305,730 D326G probably null Het
Dach1 A G 14: 97,915,924 V436A probably damaging Het
Dnah11 C T 12: 118,060,407 G1870S probably damaging Het
Dst C A 1: 34,244,383 H5324N probably damaging Het
Eapp TTTCTTCTTCTTCTTCTT TTTCTTCTTCTTCTT 12: 54,685,949 probably benign Het
Esd C A 14: 74,736,027 H21N probably damaging Het
Gnmt A G 17: 46,726,345 L171P probably damaging Het
Igdcc4 T A 9: 65,131,473 probably null Het
Mug1 A T 6: 121,884,349 I1310F possibly damaging Het
Mybpc2 T C 7: 44,506,887 K834R probably benign Het
Olfr1013 T A 2: 85,770,653 L284* probably null Het
Olfr1564 T C 17: 33,215,661 K231E possibly damaging Het
Olfr516 T A 7: 108,845,233 Y259F probably damaging Het
Pcdh17 A G 14: 84,447,755 D554G probably damaging Het
Plcxd3 T A 15: 4,516,862 L116* probably null Het
Prss1 A C 6: 41,463,588 D199A probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rreb1 A G 13: 37,932,231 M1189V probably benign Het
Slc25a39 T C 11: 102,405,051 E118G probably damaging Het
Slfn5 G T 11: 82,961,338 M763I probably benign Het
Speer4f2 A G 5: 17,374,404 E67G probably damaging Het
Spef2 A T 15: 9,704,550 probably null Het
Spocd1 A T 4: 129,948,870 D26V possibly damaging Het
Ssh1 A G 5: 113,970,436 L50P probably damaging Het
Tle1 A G 4: 72,118,534 L728P probably damaging Het
Trio A G 15: 27,741,250 probably null Het
Tubb1 G A 2: 174,455,756 E53K probably damaging Het
Vmn2r71 A T 7: 85,623,681 T568S possibly damaging Het
Other mutations in Rbms3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Rbms3 APN 9 117110115 missense probably damaging 0.99
IGL01859:Rbms3 APN 9 116959538 missense probably damaging 1.00
IGL01962:Rbms3 APN 9 116695811 splice site probably benign
IGL03034:Rbms3 APN 9 117251811 utr 5 prime probably benign
PIT4810001:Rbms3 UTSW 9 117056793 missense probably damaging 0.98
R0862:Rbms3 UTSW 9 117629792 splice site probably benign
R0864:Rbms3 UTSW 9 117629792 splice site probably benign
R1796:Rbms3 UTSW 9 116719333 missense probably damaging 1.00
R1808:Rbms3 UTSW 9 116822826 missense probably damaging 1.00
R1826:Rbms3 UTSW 9 116822868 missense probably damaging 1.00
R2213:Rbms3 UTSW 9 116959466 critical splice donor site probably null
R3719:Rbms3 UTSW 9 116582862 missense probably benign 0.11
R3935:Rbms3 UTSW 9 116636391 missense probably damaging 1.00
R4270:Rbms3 UTSW 9 117056748 missense probably damaging 1.00
R4822:Rbms3 UTSW 9 116944373 intron probably benign
R4943:Rbms3 UTSW 9 116678505 intron probably benign
R5445:Rbms3 UTSW 9 117251785 missense possibly damaging 0.74
R5997:Rbms3 UTSW 9 116719389 missense probably damaging 1.00
R6848:Rbms3 UTSW 9 117251741 missense probably damaging 1.00
R6944:Rbms3 UTSW 9 117110105 missense probably damaging 0.99
R7205:Rbms3 UTSW 9 116586017 critical splice donor site probably null
R7419:Rbms3 UTSW 9 116822826 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAATCACCTGCGTCATTGACACC -3'
(R):5'- TGTTTGCAGCAGTCCTATGCACC -3'

Sequencing Primer
(F):5'- CTCCAGCTTTATCAGTGAAGGAC -3'
(R):5'- CAGTCCTATGCACCAGCTC -3'
Posted On2013-11-07