Incidental Mutation 'R0939:Cdcp1'
ID81315
Institutional Source Beutler Lab
Gene Symbol Cdcp1
Ensembl Gene ENSMUSG00000035498
Gene NameCUB domain containing protein 1
Synonyms
MMRRC Submission 039078-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0939 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location123170824-123216038 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123183690 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 264 (V264A)
Ref Sequence ENSEMBL: ENSMUSP00000042057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039229]
Predicted Effect probably damaging
Transcript: ENSMUST00000039229
AA Change: V264A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042057
Gene: ENSMUSG00000035498
AA Change: V264A

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
internal_repeat_1 56 267 1.33e-11 PROSPERO
internal_repeat_1 374 591 1.33e-11 PROSPERO
transmembrane domain 668 690 N/A INTRINSIC
low complexity region 770 782 N/A INTRINSIC
low complexity region 792 802 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140915
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein which contains three extracellular CUB domains and acts as a substrate for Src family kinases. The protein plays a role in the tyrosine phosphorylation-dependent regulation of cellular events that are involved in tumor invasion and metastasis. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C T 11: 120,012,143 V419M probably damaging Het
Cfap53 A G 18: 74,305,730 D326G probably null Het
Dach1 A G 14: 97,915,924 V436A probably damaging Het
Dnah11 C T 12: 118,060,407 G1870S probably damaging Het
Dst C A 1: 34,244,383 H5324N probably damaging Het
Eapp TTTCTTCTTCTTCTTCTT TTTCTTCTTCTTCTT 12: 54,685,949 probably benign Het
Esd C A 14: 74,736,027 H21N probably damaging Het
Gnmt A G 17: 46,726,345 L171P probably damaging Het
Igdcc4 T A 9: 65,131,473 probably null Het
Mug1 A T 6: 121,884,349 I1310F possibly damaging Het
Mybpc2 T C 7: 44,506,887 K834R probably benign Het
Olfr1013 T A 2: 85,770,653 L284* probably null Het
Olfr1564 T C 17: 33,215,661 K231E possibly damaging Het
Olfr516 T A 7: 108,845,233 Y259F probably damaging Het
Pcdh17 A G 14: 84,447,755 D554G probably damaging Het
Plcxd3 T A 15: 4,516,862 L116* probably null Het
Prss1 A C 6: 41,463,588 D199A probably damaging Het
Rbms3 C T 9: 117,109,960 probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rreb1 A G 13: 37,932,231 M1189V probably benign Het
Slc25a39 T C 11: 102,405,051 E118G probably damaging Het
Slfn5 G T 11: 82,961,338 M763I probably benign Het
Speer4f2 A G 5: 17,374,404 E67G probably damaging Het
Spef2 A T 15: 9,704,550 probably null Het
Spocd1 A T 4: 129,948,870 D26V possibly damaging Het
Ssh1 A G 5: 113,970,436 L50P probably damaging Het
Tle1 A G 4: 72,118,534 L728P probably damaging Het
Trio A G 15: 27,741,250 probably null Het
Tubb1 G A 2: 174,455,756 E53K probably damaging Het
Vmn2r71 A T 7: 85,623,681 T568S possibly damaging Het
Other mutations in Cdcp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01757:Cdcp1 APN 9 123180001 nonsense probably null
IGL01883:Cdcp1 APN 9 123183598 missense probably benign 0.18
IGL02029:Cdcp1 APN 9 123183834 splice site probably benign
IGL02115:Cdcp1 APN 9 123185397 missense probably damaging 1.00
IGL02516:Cdcp1 APN 9 123173637 missense possibly damaging 0.86
IGL02709:Cdcp1 APN 9 123173814 missense probably damaging 1.00
IGL03263:Cdcp1 APN 9 123180087 missense probably benign 0.12
IGL03406:Cdcp1 APN 9 123185313 missense probably benign 0.00
R0242:Cdcp1 UTSW 9 123180172 missense probably benign 0.00
R0242:Cdcp1 UTSW 9 123180172 missense probably benign 0.00
R1411:Cdcp1 UTSW 9 123190112 missense probably damaging 0.99
R1460:Cdcp1 UTSW 9 123180027 missense possibly damaging 0.69
R1538:Cdcp1 UTSW 9 123173588 missense probably damaging 1.00
R1660:Cdcp1 UTSW 9 123185362 missense probably benign 0.09
R1673:Cdcp1 UTSW 9 123178021 nonsense probably null
R1794:Cdcp1 UTSW 9 123190094 missense probably benign 0.37
R1794:Cdcp1 UTSW 9 123215831 missense probably benign
R2472:Cdcp1 UTSW 9 123185107 missense probably benign 0.07
R3961:Cdcp1 UTSW 9 123182381 missense possibly damaging 0.73
R3962:Cdcp1 UTSW 9 123182381 missense possibly damaging 0.73
R4288:Cdcp1 UTSW 9 123183628 missense probably damaging 0.99
R4888:Cdcp1 UTSW 9 123182129 intron probably benign
R4953:Cdcp1 UTSW 9 123180023 missense probably benign 0.00
R5236:Cdcp1 UTSW 9 123185193 missense probably damaging 1.00
R5546:Cdcp1 UTSW 9 123178029 missense probably damaging 1.00
R5848:Cdcp1 UTSW 9 123183705 missense possibly damaging 0.87
R5903:Cdcp1 UTSW 9 123173772 nonsense probably null
R6052:Cdcp1 UTSW 9 123185331 missense probably benign 0.04
R6344:Cdcp1 UTSW 9 123182382 missense possibly damaging 0.69
R6904:Cdcp1 UTSW 9 123173915 missense probably benign
R7038:Cdcp1 UTSW 9 123173597 missense probably damaging 1.00
R7092:Cdcp1 UTSW 9 123183613 missense probably benign 0.20
R7262:Cdcp1 UTSW 9 123173615 missense probably damaging 1.00
R7275:Cdcp1 UTSW 9 123185054 missense possibly damaging 0.79
R7294:Cdcp1 UTSW 9 123177921 missense probably benign 0.01
R7373:Cdcp1 UTSW 9 123177900 missense probably damaging 1.00
R7394:Cdcp1 UTSW 9 123173813 missense probably damaging 1.00
R7527:Cdcp1 UTSW 9 123185107 missense probably benign 0.26
R7680:Cdcp1 UTSW 9 123183519 missense probably damaging 1.00
X0028:Cdcp1 UTSW 9 123185184 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTTCATCCTGTGGACGTTGGAC -3'
(R):5'- AGCCAGGACAGGTATCAGCATCTC -3'

Sequencing Primer
(F):5'- CTGAAGCCGAAGGATTCCTG -3'
(R):5'- GGACAGGTATCAGCATCTCCTTTC -3'
Posted On2013-11-07