Incidental Mutation 'R0939:Eapp'
ID81325
Institutional Source Beutler Lab
Gene Symbol Eapp
Ensembl Gene ENSMUSG00000054302
Gene NameE2F-associated phosphoprotein
Synonyms1810011O16Rik, EAPP
MMRRC Submission 039078-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.905) question?
Stock #R0939 (G1)
Quality Score121
Status Not validated
Chromosome12
Chromosomal Location54670340-54695897 bp(-) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) TTTCTTCTTCTTCTTCTT to TTTCTTCTTCTTCTT at 54685949 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067272] [ENSMUST00000110713] [ENSMUST00000160085] [ENSMUST00000161592] [ENSMUST00000162106] [ENSMUST00000163433]
Predicted Effect probably benign
Transcript: ENSMUST00000067272
SMART Domains Protein: ENSMUSP00000069381
Gene: ENSMUSG00000054302

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110713
SMART Domains Protein: ENSMUSP00000106341
Gene: ENSMUSG00000054302

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 52 68 N/A INTRINSIC
low complexity region 80 97 N/A INTRINSIC
low complexity region 116 125 N/A INTRINSIC
Pfam:Eapp_C 153 241 1.1e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160085
SMART Domains Protein: ENSMUSP00000124699
Gene: ENSMUSG00000054302

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 52 68 N/A INTRINSIC
low complexity region 80 97 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161592
SMART Domains Protein: ENSMUSP00000123698
Gene: ENSMUSG00000054302

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 52 68 N/A INTRINSIC
low complexity region 80 97 N/A INTRINSIC
low complexity region 116 125 N/A INTRINSIC
Pfam:Eapp_C 136 279 5e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162106
SMART Domains Protein: ENSMUSP00000124232
Gene: ENSMUSG00000054302

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 52 68 N/A INTRINSIC
low complexity region 112 121 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163433
SMART Domains Protein: ENSMUSP00000130251
Gene: ENSMUSG00000054302

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 52 68 N/A INTRINSIC
low complexity region 80 97 N/A INTRINSIC
low complexity region 116 125 N/A INTRINSIC
Pfam:Eapp_C 136 279 5.8e-52 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphoprotein that interacts with several members of the E2F family of proteins. The protein localizes to the nucleus, and is present throughout the cell cycle except during mitosis. It functions to modulate E2F-regulated transcription and stimulate proliferation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C T 11: 120,012,143 V419M probably damaging Het
Cdcp1 A G 9: 123,183,690 V264A probably damaging Het
Cfap53 A G 18: 74,305,730 D326G probably null Het
Dach1 A G 14: 97,915,924 V436A probably damaging Het
Dnah11 C T 12: 118,060,407 G1870S probably damaging Het
Dst C A 1: 34,244,383 H5324N probably damaging Het
Esd C A 14: 74,736,027 H21N probably damaging Het
Gnmt A G 17: 46,726,345 L171P probably damaging Het
Igdcc4 T A 9: 65,131,473 probably null Het
Mug1 A T 6: 121,884,349 I1310F possibly damaging Het
Mybpc2 T C 7: 44,506,887 K834R probably benign Het
Olfr1013 T A 2: 85,770,653 L284* probably null Het
Olfr1564 T C 17: 33,215,661 K231E possibly damaging Het
Olfr516 T A 7: 108,845,233 Y259F probably damaging Het
Pcdh17 A G 14: 84,447,755 D554G probably damaging Het
Plcxd3 T A 15: 4,516,862 L116* probably null Het
Prss1 A C 6: 41,463,588 D199A probably damaging Het
Rbms3 C T 9: 117,109,960 probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rreb1 A G 13: 37,932,231 M1189V probably benign Het
Slc25a39 T C 11: 102,405,051 E118G probably damaging Het
Slfn5 G T 11: 82,961,338 M763I probably benign Het
Speer4f2 A G 5: 17,374,404 E67G probably damaging Het
Spef2 A T 15: 9,704,550 probably null Het
Spocd1 A T 4: 129,948,870 D26V possibly damaging Het
Ssh1 A G 5: 113,970,436 L50P probably damaging Het
Tle1 A G 4: 72,118,534 L728P probably damaging Het
Trio A G 15: 27,741,250 probably null Het
Tubb1 G A 2: 174,455,756 E53K probably damaging Het
Vmn2r71 A T 7: 85,623,681 T568S possibly damaging Het
Other mutations in Eapp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Eapp APN 12 54692808 missense possibly damaging 0.78
IGL01964:Eapp APN 12 54685935 missense probably damaging 0.99
IGL02591:Eapp APN 12 54692822 missense probably damaging 1.00
IGL03323:Eapp APN 12 54673615 missense probably damaging 1.00
IGL03328:Eapp APN 12 54692093 missense probably benign 0.04
R0599:Eapp UTSW 12 54685962 missense probably damaging 1.00
R1583:Eapp UTSW 12 54685948 nonsense probably null
R1646:Eapp UTSW 12 54685960 nonsense probably null
R1935:Eapp UTSW 12 54673728 missense probably benign 0.01
R1936:Eapp UTSW 12 54673728 missense probably benign 0.01
R5303:Eapp UTSW 12 54692918 missense probably damaging 1.00
R5537:Eapp UTSW 12 54692059 missense probably benign 0.22
R7638:Eapp UTSW 12 54673723 missense probably benign 0.02
R8041:Eapp UTSW 12 54692865 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGGACAGACAGACGGATTAAAGACTAT -3'
(R):5'- CAAGTGCCAGGGCTGCTAAAGAA -3'

Sequencing Primer
(F):5'- GACAGACGGATTAAAGACTATTTGAC -3'
(R):5'- actcactgcccctctcc -3'
Posted On2013-11-07