Incidental Mutation 'R0939:Esd'
Institutional Source Beutler Lab
Gene Symbol Esd
Ensembl Gene ENSMUSG00000021996
Gene Nameesterase D/formylglutathione hydrolase
SynonymsEs10, Es-10, Esd
MMRRC Submission 039078-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.247) question?
Stock #R0939 (G1)
Quality Score225
Status Not validated
Chromosomal Location74732297-74750765 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 74736027 bp
Amino Acid Change Histidine to Asparagine at position 21 (H21N)
Ref Sequence ENSEMBL: ENSMUSP00000135063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022573] [ENSMUST00000175712] [ENSMUST00000175887] [ENSMUST00000176957] [ENSMUST00000177137] [ENSMUST00000177181] [ENSMUST00000177283]
Predicted Effect probably damaging
Transcript: ENSMUST00000022573
AA Change: H21N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022573
Gene: ENSMUSG00000021996
AA Change: H21N

Pfam:Esterase 23 275 8.1e-74 PFAM
Pfam:Chlorophyllase2 29 184 2.7e-8 PFAM
Pfam:Esterase_phd 30 231 1e-7 PFAM
Pfam:Abhydrolase_5 48 261 4.6e-9 PFAM
Pfam:Peptidase_S9 102 282 2.2e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000175712
AA Change: H21N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134932
Gene: ENSMUSG00000021996
AA Change: H21N

Pfam:Esterase 23 131 4.5e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000175887
AA Change: H21N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135244
Gene: ENSMUSG00000021996
AA Change: H21N

Pfam:Esterase 23 242 1.3e-57 PFAM
Pfam:Chlorophyllase2 29 186 2.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176188
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176484
Predicted Effect probably benign
Transcript: ENSMUST00000176726
Predicted Effect probably damaging
Transcript: ENSMUST00000176957
AA Change: H34N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135394
Gene: ENSMUSG00000021996
AA Change: H34N

Pfam:AXE1 26 198 1e-7 PFAM
Pfam:Esterase 36 288 6.6e-74 PFAM
Pfam:Abhydrolase_5 61 274 7.1e-9 PFAM
Pfam:Peptidase_S9 116 295 2.4e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177137
AA Change: H21N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135818
Gene: ENSMUSG00000021996
AA Change: H21N

Pfam:Esterase 23 259 1.4e-68 PFAM
Pfam:Chlorophyllase2 29 184 2.2e-8 PFAM
Pfam:Esterase_phd 30 231 7.9e-8 PFAM
Pfam:Abhydrolase_5 48 247 5.3e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177181
AA Change: H21N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135035
Gene: ENSMUSG00000021996
AA Change: H21N

Pfam:Esterase 23 261 2e-68 PFAM
Pfam:Chlorophyllase2 29 184 2.3e-8 PFAM
Pfam:Esterase_phd 30 231 8.4e-8 PFAM
Pfam:Abhydrolase_5 48 248 5.6e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177283
AA Change: H21N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135063
Gene: ENSMUSG00000021996
AA Change: H21N

Pfam:AXE1 16 185 1.1e-7 PFAM
Pfam:Esterase 23 247 1e-67 PFAM
Pfam:Chlorophyllase2 29 184 1.9e-8 PFAM
Pfam:Esterase_phd 30 231 2.5e-8 PFAM
Pfam:Abhydrolase_5 48 239 5.9e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177445
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C T 11: 120,012,143 V419M probably damaging Het
Cdcp1 A G 9: 123,183,690 V264A probably damaging Het
Cfap53 A G 18: 74,305,730 D326G probably null Het
Dach1 A G 14: 97,915,924 V436A probably damaging Het
Dnah11 C T 12: 118,060,407 G1870S probably damaging Het
Dst C A 1: 34,244,383 H5324N probably damaging Het
Eapp TTTCTTCTTCTTCTTCTT TTTCTTCTTCTTCTT 12: 54,685,949 probably benign Het
Gnmt A G 17: 46,726,345 L171P probably damaging Het
Igdcc4 T A 9: 65,131,473 probably null Het
Mug1 A T 6: 121,884,349 I1310F possibly damaging Het
Mybpc2 T C 7: 44,506,887 K834R probably benign Het
Olfr1013 T A 2: 85,770,653 L284* probably null Het
Olfr1564 T C 17: 33,215,661 K231E possibly damaging Het
Olfr516 T A 7: 108,845,233 Y259F probably damaging Het
Pcdh17 A G 14: 84,447,755 D554G probably damaging Het
Plcxd3 T A 15: 4,516,862 L116* probably null Het
Prss1 A C 6: 41,463,588 D199A probably damaging Het
Rbms3 C T 9: 117,109,960 probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rreb1 A G 13: 37,932,231 M1189V probably benign Het
Slc25a39 T C 11: 102,405,051 E118G probably damaging Het
Slfn5 G T 11: 82,961,338 M763I probably benign Het
Speer4f2 A G 5: 17,374,404 E67G probably damaging Het
Spef2 A T 15: 9,704,550 probably null Het
Spocd1 A T 4: 129,948,870 D26V possibly damaging Het
Ssh1 A G 5: 113,970,436 L50P probably damaging Het
Tle1 A G 4: 72,118,534 L728P probably damaging Het
Trio A G 15: 27,741,250 probably null Het
Tubb1 G A 2: 174,455,756 E53K probably damaging Het
Vmn2r71 A T 7: 85,623,681 T568S possibly damaging Het
Other mutations in Esd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Esd APN 14 74736027 missense probably damaging 1.00
IGL00534:Esd APN 14 74738461 missense probably damaging 0.99
IGL00904:Esd APN 14 74749688 makesense probably null
IGL01645:Esd APN 14 74749719 missense probably benign 0.00
IGL03117:Esd APN 14 74741246 missense probably damaging 1.00
R0766:Esd UTSW 14 74742121 missense probably damaging 1.00
R1862:Esd UTSW 14 74742074 missense probably damaging 1.00
R1892:Esd UTSW 14 74749673 missense probably damaging 0.96
R3922:Esd UTSW 14 74743227 missense probably benign 0.00
R4580:Esd UTSW 14 74742077 missense possibly damaging 0.55
R4830:Esd UTSW 14 74741160 missense probably damaging 1.00
R4969:Esd UTSW 14 74744713 missense possibly damaging 0.76
R5211:Esd UTSW 14 74741192 missense probably damaging 1.00
R5335:Esd UTSW 14 74742113 missense probably damaging 0.99
R5810:Esd UTSW 14 74745611 missense probably damaging 1.00
R7024:Esd UTSW 14 74744662 missense probably damaging 1.00
R7759:Esd UTSW 14 74745567 nonsense probably null
R8673:Esd UTSW 14 74732512 missense probably benign 0.15
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- tgcctttaatctcagcactttaatc -3'
Posted On2013-11-07