Incidental Mutation 'R0939:Plcxd3'
ID81335
Institutional Source Beutler Lab
Gene Symbol Plcxd3
Ensembl Gene ENSMUSG00000049148
Gene Namephosphatidylinositol-specific phospholipase C, X domain containing 3
Synonyms
MMRRC Submission 039078-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R0939 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location4375491-4575553 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 4516862 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 116 (L116*)
Ref Sequence ENSEMBL: ENSMUSP00000053553 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061925] [ENSMUST00000130332]
Predicted Effect probably null
Transcript: ENSMUST00000061925
AA Change: L116*
SMART Domains Protein: ENSMUSP00000053553
Gene: ENSMUSG00000049148
AA Change: L116*

DomainStartEndE-ValueType
SCOP:d2ptd__ 2 311 2e-62 SMART
PDB:1AOD|A 7 166 1e-8 PDB
Blast:PLCXc 23 148 3e-17 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130332
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C T 11: 120,012,143 V419M probably damaging Het
Cdcp1 A G 9: 123,183,690 V264A probably damaging Het
Cfap53 A G 18: 74,305,730 D326G probably null Het
Dach1 A G 14: 97,915,924 V436A probably damaging Het
Dnah11 C T 12: 118,060,407 G1870S probably damaging Het
Dst C A 1: 34,244,383 H5324N probably damaging Het
Eapp TTTCTTCTTCTTCTTCTT TTTCTTCTTCTTCTT 12: 54,685,949 probably benign Het
Esd C A 14: 74,736,027 H21N probably damaging Het
Gnmt A G 17: 46,726,345 L171P probably damaging Het
Igdcc4 T A 9: 65,131,473 probably null Het
Mug1 A T 6: 121,884,349 I1310F possibly damaging Het
Mybpc2 T C 7: 44,506,887 K834R probably benign Het
Olfr1013 T A 2: 85,770,653 L284* probably null Het
Olfr1564 T C 17: 33,215,661 K231E possibly damaging Het
Olfr516 T A 7: 108,845,233 Y259F probably damaging Het
Pcdh17 A G 14: 84,447,755 D554G probably damaging Het
Prss1 A C 6: 41,463,588 D199A probably damaging Het
Rbms3 C T 9: 117,109,960 probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rreb1 A G 13: 37,932,231 M1189V probably benign Het
Slc25a39 T C 11: 102,405,051 E118G probably damaging Het
Slfn5 G T 11: 82,961,338 M763I probably benign Het
Speer4f2 A G 5: 17,374,404 E67G probably damaging Het
Spef2 A T 15: 9,704,550 probably null Het
Spocd1 A T 4: 129,948,870 D26V possibly damaging Het
Ssh1 A G 5: 113,970,436 L50P probably damaging Het
Tle1 A G 4: 72,118,534 L728P probably damaging Het
Trio A G 15: 27,741,250 probably null Het
Tubb1 G A 2: 174,455,756 E53K probably damaging Het
Vmn2r71 A T 7: 85,623,681 T568S possibly damaging Het
Other mutations in Plcxd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02642:Plcxd3 APN 15 4516640 missense possibly damaging 0.91
IGL02743:Plcxd3 APN 15 4574803 missense possibly damaging 0.92
IGL03230:Plcxd3 APN 15 4516790 missense probably damaging 0.99
R0599:Plcxd3 UTSW 15 4516867 missense probably damaging 0.96
R0724:Plcxd3 UTSW 15 4516868 missense probably damaging 0.99
R1536:Plcxd3 UTSW 15 4516611 splice site probably benign
R1648:Plcxd3 UTSW 15 4375809 missense probably benign
R1858:Plcxd3 UTSW 15 4516611 splice site probably benign
R2418:Plcxd3 UTSW 15 4574763 missense probably benign 0.04
R2419:Plcxd3 UTSW 15 4574763 missense probably benign 0.04
R4640:Plcxd3 UTSW 15 4517243 missense probably damaging 0.99
R4702:Plcxd3 UTSW 15 4375787 missense probably benign
R5372:Plcxd3 UTSW 15 4574788 missense probably benign
R5705:Plcxd3 UTSW 15 4517194 missense probably benign 0.43
R6302:Plcxd3 UTSW 15 4516757 missense probably damaging 1.00
R7050:Plcxd3 UTSW 15 4516718 missense probably damaging 0.96
R7283:Plcxd3 UTSW 15 4516919 missense probably damaging 0.97
R7856:Plcxd3 UTSW 15 4517099 missense probably damaging 0.98
R7939:Plcxd3 UTSW 15 4517099 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTGTTCGGAACTGTAGCCAAGAAG -3'
(R):5'- ATCATCTGTCCAGGCCAGAGGAAG -3'

Sequencing Primer
(F):5'- CTGTAGCCAAGAAGTTGATGC -3'
(R):5'- TCACTTCCTGGGCAAAAATGG -3'
Posted On2013-11-07