Incidental Mutation 'R0939:Gnmt'
ID81345
Institutional Source Beutler Lab
Gene Symbol Gnmt
Ensembl Gene ENSMUSG00000002769
Gene Nameglycine N-methyltransferase
Synonymsglycine N methyl transferase
MMRRC Submission 039078-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.315) question?
Stock #R0939 (G1)
Quality Score219
Status Not validated
Chromosome17
Chromosomal Location46725664-46729168 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46726345 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 171 (L171P)
Ref Sequence ENSEMBL: ENSMUSP00000002846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002840] [ENSMUST00000002846]
PDB Structure
Crystal Structure of Mouse Glycine N-Methyltransferase (Tetragonal Form) [X-RAY DIFFRACTION]
Crystal Structure of Mouse Glycine N-Methyltransferase (Monoclinic Form) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000002840
SMART Domains Protein: ENSMUSP00000002840
Gene: ENSMUSG00000002763

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
low complexity region 72 86 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 112 128 N/A INTRINSIC
low complexity region 173 200 N/A INTRINSIC
AAA 463 598 6.1e-7 SMART
AAA 737 875 6e-24 SMART
Blast:AAA 928 973 1e-14 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000002846
AA Change: L171P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002846
Gene: ENSMUSG00000002769
AA Change: L171P

DomainStartEndE-ValueType
Pfam:Methyltransf_23 27 217 9e-11 PFAM
Pfam:Methyltransf_31 56 224 1.3e-15 PFAM
Pfam:Methyltransf_18 57 176 1.5e-15 PFAM
Pfam:Methyltransf_25 61 169 1.4e-10 PFAM
Pfam:Methyltransf_12 62 171 4e-12 PFAM
Pfam:Methyltransf_11 62 173 2.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144964
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148872
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181301
Meta Mutation Damage Score 0.9479 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an enzyme that catalyzes the conversion of S-adenosyl-L-methionine (along with glycine) to S-adenosyl-L-homocysteine and sarcosine. This protein is found in the cytoplasm and acts as a homotetramer. Defects in this gene are a cause of GNMT deficiency (hypermethioninemia). Alternative splicing results in multiple transcript variants. Naturally occurring readthrough transcription occurs between the upstream CNPY3 (canopy FGF signaling regulator 3) gene and this gene and is represented with GeneID:107080644. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a null mutation display elevated levels of methionine and S-adenosylmethionine in the liver. Mice homozygous for another null allele exhibit hepatitis, increased hepatic glycogen storage, and hepatocellular carcinoma. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C T 11: 120,012,143 V419M probably damaging Het
Cdcp1 A G 9: 123,183,690 V264A probably damaging Het
Cfap53 A G 18: 74,305,730 D326G probably null Het
Dach1 A G 14: 97,915,924 V436A probably damaging Het
Dnah11 C T 12: 118,060,407 G1870S probably damaging Het
Dst C A 1: 34,244,383 H5324N probably damaging Het
Eapp TTTCTTCTTCTTCTTCTT TTTCTTCTTCTTCTT 12: 54,685,949 probably benign Het
Esd C A 14: 74,736,027 H21N probably damaging Het
Igdcc4 T A 9: 65,131,473 probably null Het
Mug1 A T 6: 121,884,349 I1310F possibly damaging Het
Mybpc2 T C 7: 44,506,887 K834R probably benign Het
Olfr1013 T A 2: 85,770,653 L284* probably null Het
Olfr1564 T C 17: 33,215,661 K231E possibly damaging Het
Olfr516 T A 7: 108,845,233 Y259F probably damaging Het
Pcdh17 A G 14: 84,447,755 D554G probably damaging Het
Plcxd3 T A 15: 4,516,862 L116* probably null Het
Prss1 A C 6: 41,463,588 D199A probably damaging Het
Rbms3 C T 9: 117,109,960 probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rreb1 A G 13: 37,932,231 M1189V probably benign Het
Slc25a39 T C 11: 102,405,051 E118G probably damaging Het
Slfn5 G T 11: 82,961,338 M763I probably benign Het
Speer4f2 A G 5: 17,374,404 E67G probably damaging Het
Spef2 A T 15: 9,704,550 probably null Het
Spocd1 A T 4: 129,948,870 D26V possibly damaging Het
Ssh1 A G 5: 113,970,436 L50P probably damaging Het
Tle1 A G 4: 72,118,534 L728P probably damaging Het
Trio A G 15: 27,741,250 probably null Het
Tubb1 G A 2: 174,455,756 E53K probably damaging Het
Vmn2r71 A T 7: 85,623,681 T568S possibly damaging Het
Other mutations in Gnmt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01351:Gnmt APN 17 46726680 missense probably benign 0.28
health_nut UTSW 17 46726345 missense probably damaging 1.00
R0480:Gnmt UTSW 17 46725928 missense probably benign 0.06
R0938:Gnmt UTSW 17 46726345 missense probably damaging 1.00
R0940:Gnmt UTSW 17 46726345 missense probably damaging 1.00
R0941:Gnmt UTSW 17 46726345 missense probably damaging 1.00
R3619:Gnmt UTSW 17 46729037 missense possibly damaging 0.63
R4173:Gnmt UTSW 17 46726121 missense probably damaging 1.00
R4456:Gnmt UTSW 17 46728984 missense probably benign 0.07
R4498:Gnmt UTSW 17 46725736 utr 3 prime probably benign
R4659:Gnmt UTSW 17 46725966 missense probably damaging 1.00
R4669:Gnmt UTSW 17 46726299 nonsense probably null
R4827:Gnmt UTSW 17 46727319 missense possibly damaging 0.77
R5112:Gnmt UTSW 17 46726330 missense probably damaging 1.00
R5133:Gnmt UTSW 17 46725934 missense probably benign
R5797:Gnmt UTSW 17 46726379 missense probably damaging 1.00
R7423:Gnmt UTSW 17 46726140 missense probably damaging 1.00
R7825:Gnmt UTSW 17 46729093 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATACCTGAAGCCAGGAGAGCCATC -3'
(R):5'- TGCTCACTTGCCAGACTGCAAAG -3'

Sequencing Primer
(F):5'- AGAGCCATCTCTGCCAGTG -3'
(R):5'- CTGATAAGGCAGACCTGCATTTTG -3'
Posted On2013-11-07