Incidental Mutation 'R0963:Gm13078'
ID81354
Institutional Source Beutler Lab
Gene Symbol Gm13078
Ensembl Gene ENSMUSG00000046435
Gene Namepredicted gene 13078
Synonyms
MMRRC Submission 039092-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R0963 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location143719455-143729158 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 143727108 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 262 (I262N)
Ref Sequence ENSEMBL: ENSMUSP00000077761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078695]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078695
AA Change: I262N

PolyPhen 2 Score 0.504 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000077761
Gene: ENSMUSG00000046435
AA Change: I262N

DomainStartEndE-ValueType
SCOP:d1a4ya_ 204 412 4e-12 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025F22Rik T C 19: 11,141,557 T63A possibly damaging Het
Adarb2 A G 13: 8,672,415 D369G probably damaging Het
Adcy7 T C 8: 88,312,265 V303A probably damaging Het
Afap1l1 A T 18: 61,736,930 Y610N probably damaging Het
Agr3 T A 12: 35,934,434 H53Q probably benign Het
Akr1d1 A G 6: 37,530,274 I10M probably damaging Het
Atp4b G T 8: 13,390,014 H111N probably benign Het
Bbs7 G T 3: 36,613,263 A8E probably benign Het
Bsn C T 9: 108,111,807 V2249M possibly damaging Het
Cpt1a T C 19: 3,381,634 S685P probably damaging Het
Dhx57 A T 17: 80,275,527 H163Q probably benign Het
Duox2 A C 2: 122,287,172 C894G probably benign Het
Ecm1 T C 3: 95,736,588 T209A possibly damaging Het
Glo1 T C 17: 30,600,111 N79S probably benign Het
Gm4763 A T 7: 24,723,622 D90E probably benign Het
Htra1 T A 7: 130,982,279 M388K possibly damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Jag2 C T 12: 112,915,314 E496K probably damaging Het
Kcnh2 C T 5: 24,322,672 R894H probably damaging Het
Khdc1c A G 1: 21,369,609 N128S probably benign Het
Lamc1 T C 1: 153,243,386 N829S probably benign Het
Leprotl1 T C 8: 34,139,035 Y33C probably damaging Het
Map3k3 T A 11: 106,123,792 S130T probably benign Het
Mip C T 10: 128,225,985 A35V probably benign Het
Myh15 A G 16: 49,132,149 R861G probably damaging Het
Myom1 A C 17: 71,077,767 I718L possibly damaging Het
Naip6 C T 13: 100,316,475 R26H probably benign Het
Olfr677 G A 7: 105,056,972 C242Y probably damaging Het
Pde6b A G 5: 108,430,668 E824G probably benign Het
Rbm19 T G 5: 120,130,734 S476A possibly damaging Het
Rpl39l T A 16: 10,174,298 probably null Het
Sec24b A G 3: 130,040,905 S79P probably benign Het
Slc15a2 G A 16: 36,774,573 A146V probably damaging Het
Slmap T C 14: 26,468,520 Y161C probably damaging Het
Smc4 T A 3: 69,025,926 C652S probably damaging Het
Stab1 A G 14: 31,147,274 I1499T probably damaging Het
Tnnt1 A G 7: 4,507,595 L209P probably damaging Het
Trim52 T G 14: 106,107,539 S210R probably benign Het
Tsc22d1 T A 14: 76,418,599 N82K possibly damaging Het
Wdr75 T C 1: 45,817,310 Y498H probably benign Het
Zfp955a C T 17: 33,243,752 S56N probably benign Het
Other mutations in Gm13078
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00976:Gm13078 APN 4 143727015 missense probably damaging 1.00
IGL01122:Gm13078 APN 4 143728401 missense probably benign 0.13
IGL02314:Gm13078 APN 4 143728442 missense probably benign 0.00
IGL03089:Gm13078 APN 4 143726133 missense probably benign 0.43
IGL03338:Gm13078 APN 4 143726742 missense probably benign 0.01
R0233:Gm13078 UTSW 4 143726063 missense possibly damaging 0.71
R0233:Gm13078 UTSW 4 143726063 missense possibly damaging 0.71
R0349:Gm13078 UTSW 4 143727059 missense probably benign 0.00
R0681:Gm13078 UTSW 4 143728052 missense probably benign
R1114:Gm13078 UTSW 4 143726855 missense probably benign 0.01
R2070:Gm13078 UTSW 4 143726902 nonsense probably null
R2475:Gm13078 UTSW 4 143726825 missense probably benign 0.14
R3824:Gm13078 UTSW 4 143726685 missense probably benign 0.00
R4050:Gm13078 UTSW 4 143727122 missense probably benign 0.01
R4125:Gm13078 UTSW 4 143726280 nonsense probably null
R4273:Gm13078 UTSW 4 143726846 nonsense probably null
R4280:Gm13078 UTSW 4 143726022 missense possibly damaging 0.94
R4921:Gm13078 UTSW 4 143728326 missense possibly damaging 0.95
R5223:Gm13078 UTSW 4 143728021 missense probably benign 0.00
R7256:Gm13078 UTSW 4 143726279 missense probably benign 0.23
R7640:Gm13078 UTSW 4 143726706 missense probably benign 0.00
R7666:Gm13078 UTSW 4 143728515 missense probably benign 0.00
R7683:Gm13078 UTSW 4 143726714 nonsense probably null
Z1088:Gm13078 UTSW 4 143727033 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTGCCTATGACCCACTGGATG -3'
(R):5'- AGTTAACACTGGCTGTGAGCCAC -3'

Sequencing Primer
(F):5'- ACCCACTGGATGTTCTGAAG -3'
(R):5'- CTGGCTGTGAGCCACTATATAATC -3'
Posted On2013-11-07