Incidental Mutation 'R0940:Cul3'
ID81355
Institutional Source Beutler Lab
Gene Symbol Cul3
Ensembl Gene ENSMUSG00000004364
Gene Namecullin 3
Synonyms
MMRRC Submission 039079-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0940 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location80264923-80340480 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 80322847 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000163119] [ENSMUST00000164108]
Predicted Effect probably benign
Transcript: ENSMUST00000163119
SMART Domains Protein: ENSMUSP00000130738
Gene: ENSMUSG00000004364

DomainStartEndE-ValueType
PDB:4AP2|B 1 389 N/A PDB
SCOP:d1ldja2 30 382 1e-117 SMART
Blast:CULLIN 258 295 2e-15 BLAST
CULLIN 413 563 1.98e-90 SMART
Cullin_Nedd8 695 762 1.49e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164108
SMART Domains Protein: ENSMUSP00000131891
Gene: ENSMUSG00000004364

DomainStartEndE-ValueType
SCOP:d1ldja2 23 316 1e-101 SMART
PDB:4APF|B 23 323 N/A PDB
Blast:CULLIN 192 229 1e-15 BLAST
CULLIN 347 497 1.98e-90 SMART
Cullin_Nedd8 629 696 1.49e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167293
SMART Domains Protein: ENSMUSP00000126630
Gene: ENSMUSG00000004364

DomainStartEndE-ValueType
Pfam:Cullin 24 85 5.8e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170897
SMART Domains Protein: ENSMUSP00000130010
Gene: ENSMUSG00000004364

DomainStartEndE-ValueType
PDB:4AP2|B 2 45 1e-24 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192816
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.1%
  • 10x: 98.0%
  • 20x: 96.7%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cullin protein family. The encoded protein plays a critical role in the polyubiquitination and subsequent degradation of specific protein substrates as the core component and scaffold protein of an E3 ubiquitin ligase complex. Complexes including the encoded protein may also play a role in late endosome maturation. Mutations in this gene are a cause of type 2E pseudohypoaldosteronism. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygotes for a targeted null mutation accumulate cyclin E, exhibit abnormal cycling in cells of extraembryonic ectoderm and trophectoderm, reduced size, abnormal gastrulation and trophoblast cells, absence of an amnion, and death by embryonic day 7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810064F22Rik C T 9: 22,208,071 noncoding transcript Het
2610021A01Rik T G 7: 41,626,434 I520M probably damaging Het
Ackr4 A G 9: 104,099,632 F39L probably damaging Het
Adgre5 C T 8: 83,733,497 S92N probably damaging Het
Adrb2 T C 18: 62,179,691 D21G probably benign Het
AI464131 A G 4: 41,497,996 Y545H probably damaging Het
Akr1c6 G A 13: 4,436,373 E60K probably benign Het
Bcl7c T A 7: 127,707,331 N96I possibly damaging Het
Brca1 A T 11: 101,532,143 S106R possibly damaging Het
C6 A T 15: 4,735,235 T138S probably benign Het
Dnah8 T A 17: 30,803,243 M3939K probably damaging Het
Dock4 T A 12: 40,631,627 probably benign Het
Dsc2 T G 18: 20,050,059 T101P probably damaging Het
Dynlt1b T C 17: 6,430,250 probably benign Het
E330013P04Rik A G 19: 60,161,922 noncoding transcript Het
Fam160a1 A G 3: 85,665,490 V952A possibly damaging Het
Fggy A G 4: 95,697,001 E39G probably benign Het
Fmo6 A T 1: 162,926,226 C116S probably benign Het
Gadd45a A G 6: 67,036,829 I44T possibly damaging Het
Gmps A G 3: 63,976,322 probably benign Het
Gnmt A G 17: 46,726,345 L171P probably damaging Het
Hnrnpm G A 17: 33,650,002 R523C probably damaging Het
Inpp5a T C 7: 139,525,738 Y202H probably damaging Het
Kank3 C T 17: 33,817,476 S106F probably damaging Het
Lmcd1 A G 6: 112,328,697 D253G probably benign Het
Lrrk2 A T 15: 91,729,081 I803F possibly damaging Het
Mybpc2 T C 7: 44,506,887 K834R probably benign Het
Mycbp2 A T 14: 103,262,693 probably benign Het
Myh4 A T 11: 67,242,863 N243Y probably damaging Het
Nfatc1 C T 18: 80,635,895 M759I probably benign Het
Nipal4 A G 11: 46,150,312 I352T possibly damaging Het
Nomo1 A G 7: 46,033,905 E25G possibly damaging Het
Olfr1221 T A 2: 89,112,075 I146L probably benign Het
Olfr128 A G 17: 37,923,700 I45V probably damaging Het
Olfr1408 A G 1: 173,130,453 S255P probably benign Het
Olfr392 T C 11: 73,814,224 N286S probably damaging Het
Olfr490 T C 7: 108,287,057 D23G probably benign Het
Olfr525 T C 7: 140,323,152 I151T probably benign Het
Pabpn1l A G 8: 122,622,444 V78A probably benign Het
Pde6b T A 5: 108,420,337 I327N possibly damaging Het
Phrf1 T C 7: 141,254,855 probably benign Het
Pkm C T 9: 59,668,535 probably benign Het
Plxna2 G A 1: 194,800,555 V1519I probably benign Het
Ppp2cb T C 8: 33,615,661 probably null Het
Prickle2 A G 6: 92,411,003 Y473H probably benign Het
Prpf3 A G 3: 95,844,223 W389R probably damaging Het
Psme4 G A 11: 30,815,264 E544K possibly damaging Het
Relb A T 7: 19,611,842 D395E probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf213 A G 11: 119,416,563 N683S probably benign Het
Rtel1 T C 2: 181,322,803 C102R probably benign Het
Sel1l3 C T 5: 53,144,037 probably benign Het
Slc8a2 A G 7: 16,144,962 T458A probably benign Het
Smc3 T A 19: 53,640,909 M931K probably benign Het
Sorbs2 T C 8: 45,796,502 V795A probably benign Het
Tgm3 A G 2: 130,012,406 S2G probably benign Het
Tpbpa T C 13: 60,940,053 T75A probably damaging Het
Trub1 A G 19: 57,485,063 probably benign Het
Uggt2 A G 14: 119,091,192 probably null Het
Ugt2a3 A G 5: 87,327,206 V393A possibly damaging Het
Vav3 T A 3: 109,562,835 M532K possibly damaging Het
Zfp616 A T 11: 74,085,024 K706N probably damaging Het
Zkscan1 T C 5: 138,093,170 F55S probably damaging Het
Other mutations in Cul3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00558:Cul3 APN 1 80288740 splice site probably benign
IGL01454:Cul3 APN 1 80304183 missense probably damaging 0.97
IGL01510:Cul3 APN 1 80282679 missense probably damaging 1.00
IGL01701:Cul3 APN 1 80277423 missense probably damaging 0.97
IGL02117:Cul3 APN 1 80323064 splice site probably benign
IGL02194:Cul3 APN 1 80323037 missense probably benign 0.03
IGL02217:Cul3 APN 1 80283767 missense probably damaging 0.97
IGL02417:Cul3 APN 1 80322902 missense probably damaging 1.00
IGL02445:Cul3 APN 1 80304169 missense possibly damaging 0.74
IGL02601:Cul3 APN 1 80271715 intron probably benign
IGL03201:Cul3 APN 1 80281427 missense probably damaging 1.00
R0467:Cul3 UTSW 1 80280863 missense probably benign 0.01
R0662:Cul3 UTSW 1 80271565 missense probably damaging 1.00
R0688:Cul3 UTSW 1 80271564 missense possibly damaging 0.63
R0761:Cul3 UTSW 1 80277486 unclassified probably benign
R0924:Cul3 UTSW 1 80290118 missense probably damaging 0.99
R0930:Cul3 UTSW 1 80290118 missense probably damaging 0.99
R1117:Cul3 UTSW 1 80280924 missense probably damaging 1.00
R1572:Cul3 UTSW 1 80282789 missense possibly damaging 0.91
R2384:Cul3 UTSW 1 80283689 missense probably damaging 0.99
R3894:Cul3 UTSW 1 80283690 missense probably damaging 0.97
R4676:Cul3 UTSW 1 80271674 missense probably damaging 1.00
R4893:Cul3 UTSW 1 80288850 missense probably damaging 0.98
R4908:Cul3 UTSW 1 80280915 missense possibly damaging 0.91
R4910:Cul3 UTSW 1 80290089 missense probably benign 0.09
R5173:Cul3 UTSW 1 80281416 missense possibly damaging 0.94
R5787:Cul3 UTSW 1 80282721 missense probably benign 0.13
R5887:Cul3 UTSW 1 80276422 missense possibly damaging 0.94
R6057:Cul3 UTSW 1 80271532 missense probably damaging 1.00
R6066:Cul3 UTSW 1 80283759 missense probably benign 0.06
R6279:Cul3 UTSW 1 80286952 missense probably damaging 0.98
R6300:Cul3 UTSW 1 80286952 missense probably damaging 0.98
R6617:Cul3 UTSW 1 80276439 missense probably damaging 1.00
R7059:Cul3 UTSW 1 80276424 missense probably benign 0.00
R7223:Cul3 UTSW 1 80287000 missense probably benign 0.14
R7774:Cul3 UTSW 1 80269294 missense probably benign
Z1088:Cul3 UTSW 1 80290091 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CAGACCACAAACTTCATCTCTTCTCAACTATT -3'
(R):5'- ttctTTGTGCTGTTTACTTCTGGTTCCT -3'

Sequencing Primer
(F):5'- AGGCTTCATGTAGCCTTGAAA -3'
(R):5'- AACAGCATTTGGGACCTTCTG -3'
Posted On2013-11-07