Incidental Mutation 'R0940:Prpf3'
ID81375
Institutional Source Beutler Lab
Gene Symbol Prpf3
Ensembl Gene ENSMUSG00000015748
Gene Namepre-mRNA processing factor 3
Synonyms
MMRRC Submission 039079-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0940 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location95830124-95855885 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95844223 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 389 (W389R)
Ref Sequence ENSEMBL: ENSMUSP00000124950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015892] [ENSMUST00000160109] [ENSMUST00000161476]
Predicted Effect probably damaging
Transcript: ENSMUST00000015892
AA Change: W389R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000015892
Gene: ENSMUSG00000015748
AA Change: W389R

DomainStartEndE-ValueType
PWI 3 76 5.99e-29 SMART
low complexity region 112 135 N/A INTRINSIC
Pfam:PRP3 308 521 1.3e-82 PFAM
low complexity region 526 534 N/A INTRINSIC
Pfam:DUF1115 544 673 1.1e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160109
SMART Domains Protein: ENSMUSP00000124302
Gene: ENSMUSG00000015748

DomainStartEndE-ValueType
PWI 3 76 5.99e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160155
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161420
Predicted Effect probably damaging
Transcript: ENSMUST00000161476
AA Change: W389R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124950
Gene: ENSMUSG00000015748
AA Change: W389R

DomainStartEndE-ValueType
PWI 3 76 5.99e-29 SMART
low complexity region 112 135 N/A INTRINSIC
Pfam:PRP3 307 522 5.4e-74 PFAM
low complexity region 526 534 N/A INTRINSIC
Pfam:DUF1115 543 674 3.2e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161482
Meta Mutation Damage Score 0.9745 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.1%
  • 10x: 98.0%
  • 20x: 96.7%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The removal of introns from nuclear pre-mRNAs occurs on complexes called spliceosomes, which are made up of 4 small nuclear ribonucleoprotein (snRNP) particles and an undefined number of transiently associated splicing factors. This gene product is one of several proteins that associate with U4 and U6 snRNPs. Mutations in this gene are associated with retinitis pigmentosa-18. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810064F22Rik C T 9: 22,208,071 noncoding transcript Het
2610021A01Rik T G 7: 41,626,434 I520M probably damaging Het
Ackr4 A G 9: 104,099,632 F39L probably damaging Het
Adgre5 C T 8: 83,733,497 S92N probably damaging Het
Adrb2 T C 18: 62,179,691 D21G probably benign Het
AI464131 A G 4: 41,497,996 Y545H probably damaging Het
Akr1c6 G A 13: 4,436,373 E60K probably benign Het
Bcl7c T A 7: 127,707,331 N96I possibly damaging Het
Brca1 A T 11: 101,532,143 S106R possibly damaging Het
C6 A T 15: 4,735,235 T138S probably benign Het
Cul3 T C 1: 80,322,847 probably benign Het
Dnah8 T A 17: 30,803,243 M3939K probably damaging Het
Dock4 T A 12: 40,631,627 probably benign Het
Dsc2 T G 18: 20,050,059 T101P probably damaging Het
Dynlt1b T C 17: 6,430,250 probably benign Het
E330013P04Rik A G 19: 60,161,922 noncoding transcript Het
Fam160a1 A G 3: 85,665,490 V952A possibly damaging Het
Fggy A G 4: 95,697,001 E39G probably benign Het
Fmo6 A T 1: 162,926,226 C116S probably benign Het
Gadd45a A G 6: 67,036,829 I44T possibly damaging Het
Gmps A G 3: 63,976,322 probably benign Het
Gnmt A G 17: 46,726,345 L171P probably damaging Het
Hnrnpm G A 17: 33,650,002 R523C probably damaging Het
Inpp5a T C 7: 139,525,738 Y202H probably damaging Het
Kank3 C T 17: 33,817,476 S106F probably damaging Het
Lmcd1 A G 6: 112,328,697 D253G probably benign Het
Lrrk2 A T 15: 91,729,081 I803F possibly damaging Het
Mybpc2 T C 7: 44,506,887 K834R probably benign Het
Mycbp2 A T 14: 103,262,693 probably benign Het
Myh4 A T 11: 67,242,863 N243Y probably damaging Het
Nfatc1 C T 18: 80,635,895 M759I probably benign Het
Nipal4 A G 11: 46,150,312 I352T possibly damaging Het
Nomo1 A G 7: 46,033,905 E25G possibly damaging Het
Olfr1221 T A 2: 89,112,075 I146L probably benign Het
Olfr128 A G 17: 37,923,700 I45V probably damaging Het
Olfr1408 A G 1: 173,130,453 S255P probably benign Het
Olfr392 T C 11: 73,814,224 N286S probably damaging Het
Olfr490 T C 7: 108,287,057 D23G probably benign Het
Olfr525 T C 7: 140,323,152 I151T probably benign Het
Pabpn1l A G 8: 122,622,444 V78A probably benign Het
Pde6b T A 5: 108,420,337 I327N possibly damaging Het
Phrf1 T C 7: 141,254,855 probably benign Het
Pkm C T 9: 59,668,535 probably benign Het
Plxna2 G A 1: 194,800,555 V1519I probably benign Het
Ppp2cb T C 8: 33,615,661 probably null Het
Prickle2 A G 6: 92,411,003 Y473H probably benign Het
Psme4 G A 11: 30,815,264 E544K possibly damaging Het
Relb A T 7: 19,611,842 D395E probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf213 A G 11: 119,416,563 N683S probably benign Het
Rtel1 T C 2: 181,322,803 C102R probably benign Het
Sel1l3 C T 5: 53,144,037 probably benign Het
Slc8a2 A G 7: 16,144,962 T458A probably benign Het
Smc3 T A 19: 53,640,909 M931K probably benign Het
Sorbs2 T C 8: 45,796,502 V795A probably benign Het
Tgm3 A G 2: 130,012,406 S2G probably benign Het
Tpbpa T C 13: 60,940,053 T75A probably damaging Het
Trub1 A G 19: 57,485,063 probably benign Het
Uggt2 A G 14: 119,091,192 probably null Het
Ugt2a3 A G 5: 87,327,206 V393A possibly damaging Het
Vav3 T A 3: 109,562,835 M532K possibly damaging Het
Zfp616 A T 11: 74,085,024 K706N probably damaging Het
Zkscan1 T C 5: 138,093,170 F55S probably damaging Het
Other mutations in Prpf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02175:Prpf3 APN 3 95834107 missense probably damaging 0.99
IGL02825:Prpf3 APN 3 95853480 missense probably damaging 1.00
R1542:Prpf3 UTSW 3 95836470 missense probably benign 0.08
R1545:Prpf3 UTSW 3 95847803 missense probably damaging 0.99
R2063:Prpf3 UTSW 3 95844239 missense probably benign
R2084:Prpf3 UTSW 3 95848989 missense probably benign 0.44
R2160:Prpf3 UTSW 3 95845230 missense probably benign 0.19
R3110:Prpf3 UTSW 3 95849800 intron probably benign
R3112:Prpf3 UTSW 3 95849800 intron probably benign
R4636:Prpf3 UTSW 3 95834170 missense probably damaging 0.99
R4671:Prpf3 UTSW 3 95851664 missense possibly damaging 0.76
R4689:Prpf3 UTSW 3 95836489 nonsense probably null
R4702:Prpf3 UTSW 3 95834092 missense probably damaging 0.97
R5080:Prpf3 UTSW 3 95833797 missense probably benign 0.45
R5177:Prpf3 UTSW 3 95849724 intron probably benign
R5290:Prpf3 UTSW 3 95853545 missense probably benign 0.39
R5397:Prpf3 UTSW 3 95853579 missense probably benign 0.09
R6329:Prpf3 UTSW 3 95832578 missense probably damaging 1.00
R7133:Prpf3 UTSW 3 95833740 splice site probably null
X0063:Prpf3 UTSW 3 95840715 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATAAGCCCTGGGTTCATTGCCAGC -3'
(R):5'- ACAGTTCAAAGCCAGTTTCCTGACTTC -3'

Sequencing Primer
(F):5'- GGTTCATTGCCAGCACTGC -3'
(R):5'- TGAGGTTTTCGTAGAATCCCAC -3'
Posted On2013-11-07