Incidental Mutation 'R0940:Vav3'
ID81377
Institutional Source Beutler Lab
Gene Symbol Vav3
Ensembl Gene ENSMUSG00000033721
Gene Namevav 3 oncogene
SynonymsIdd18.1, A530094I06Rik
MMRRC Submission 039079-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R0940 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location109340653-109685698 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 109562835 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 532 (M532K)
Ref Sequence ENSEMBL: ENSMUSP00000036270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046864]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046864
AA Change: M532K

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000036270
Gene: ENSMUSG00000033721
AA Change: M532K

DomainStartEndE-ValueType
CH 3 115 2.1e-18 SMART
low complexity region 160 175 N/A INTRINSIC
RhoGEF 196 370 5.09e-56 SMART
PH 401 504 1.88e-9 SMART
C1 514 562 2.17e-11 SMART
SH3 595 659 6.4e-6 SMART
SH2 670 752 2.59e-26 SMART
SH3 791 847 8.96e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126179
Meta Mutation Damage Score 0.1650 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.1%
  • 10x: 98.0%
  • 20x: 96.7%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the VAV gene family. The VAV proteins are guanine nucleotide exchange factors (GEFs) for Rho family GTPases that activate pathways leading to actin cytoskeletal rearrangements and transcriptional alterations. This gene product acts as a GEF preferentially for RhoG, RhoA, and to a lesser extent, RAC1, and it associates maximally with the nucleotide-free states of these GTPases. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in tachycardia, systemic arterial hypertension, cardiovascular remodeling, hyperactivity of sympathetic neurons and thus high catecholamine levels, and increased levels of kidney-related hormones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810064F22Rik C T 9: 22,208,071 noncoding transcript Het
2610021A01Rik T G 7: 41,626,434 I520M probably damaging Het
Ackr4 A G 9: 104,099,632 F39L probably damaging Het
Adgre5 C T 8: 83,733,497 S92N probably damaging Het
Adrb2 T C 18: 62,179,691 D21G probably benign Het
AI464131 A G 4: 41,497,996 Y545H probably damaging Het
Akr1c6 G A 13: 4,436,373 E60K probably benign Het
Bcl7c T A 7: 127,707,331 N96I possibly damaging Het
Brca1 A T 11: 101,532,143 S106R possibly damaging Het
C6 A T 15: 4,735,235 T138S probably benign Het
Cul3 T C 1: 80,322,847 probably benign Het
Dnah8 T A 17: 30,803,243 M3939K probably damaging Het
Dock4 T A 12: 40,631,627 probably benign Het
Dsc2 T G 18: 20,050,059 T101P probably damaging Het
Dynlt1b T C 17: 6,430,250 probably benign Het
E330013P04Rik A G 19: 60,161,922 noncoding transcript Het
Fam160a1 A G 3: 85,665,490 V952A possibly damaging Het
Fggy A G 4: 95,697,001 E39G probably benign Het
Fmo6 A T 1: 162,926,226 C116S probably benign Het
Gadd45a A G 6: 67,036,829 I44T possibly damaging Het
Gmps A G 3: 63,976,322 probably benign Het
Gnmt A G 17: 46,726,345 L171P probably damaging Het
Hnrnpm G A 17: 33,650,002 R523C probably damaging Het
Inpp5a T C 7: 139,525,738 Y202H probably damaging Het
Kank3 C T 17: 33,817,476 S106F probably damaging Het
Lmcd1 A G 6: 112,328,697 D253G probably benign Het
Lrrk2 A T 15: 91,729,081 I803F possibly damaging Het
Mybpc2 T C 7: 44,506,887 K834R probably benign Het
Mycbp2 A T 14: 103,262,693 probably benign Het
Myh4 A T 11: 67,242,863 N243Y probably damaging Het
Nfatc1 C T 18: 80,635,895 M759I probably benign Het
Nipal4 A G 11: 46,150,312 I352T possibly damaging Het
Nomo1 A G 7: 46,033,905 E25G possibly damaging Het
Olfr1221 T A 2: 89,112,075 I146L probably benign Het
Olfr128 A G 17: 37,923,700 I45V probably damaging Het
Olfr1408 A G 1: 173,130,453 S255P probably benign Het
Olfr392 T C 11: 73,814,224 N286S probably damaging Het
Olfr490 T C 7: 108,287,057 D23G probably benign Het
Olfr525 T C 7: 140,323,152 I151T probably benign Het
Pabpn1l A G 8: 122,622,444 V78A probably benign Het
Pde6b T A 5: 108,420,337 I327N possibly damaging Het
Phrf1 T C 7: 141,254,855 probably benign Het
Pkm C T 9: 59,668,535 probably benign Het
Plxna2 G A 1: 194,800,555 V1519I probably benign Het
Ppp2cb T C 8: 33,615,661 probably null Het
Prickle2 A G 6: 92,411,003 Y473H probably benign Het
Prpf3 A G 3: 95,844,223 W389R probably damaging Het
Psme4 G A 11: 30,815,264 E544K possibly damaging Het
Relb A T 7: 19,611,842 D395E probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf213 A G 11: 119,416,563 N683S probably benign Het
Rtel1 T C 2: 181,322,803 C102R probably benign Het
Sel1l3 C T 5: 53,144,037 probably benign Het
Slc8a2 A G 7: 16,144,962 T458A probably benign Het
Smc3 T A 19: 53,640,909 M931K probably benign Het
Sorbs2 T C 8: 45,796,502 V795A probably benign Het
Tgm3 A G 2: 130,012,406 S2G probably benign Het
Tpbpa T C 13: 60,940,053 T75A probably damaging Het
Trub1 A G 19: 57,485,063 probably benign Het
Uggt2 A G 14: 119,091,192 probably null Het
Ugt2a3 A G 5: 87,327,206 V393A possibly damaging Het
Zfp616 A T 11: 74,085,024 K706N probably damaging Het
Zkscan1 T C 5: 138,093,170 F55S probably damaging Het
Other mutations in Vav3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Vav3 APN 3 109528392 splice site probably benign
IGL01488:Vav3 APN 3 109657944 missense probably damaging 0.99
IGL01649:Vav3 APN 3 109562762 missense probably benign
IGL01675:Vav3 APN 3 109664413 missense probably benign 0.16
IGL02189:Vav3 APN 3 109525960 splice site probably benign
IGL03134:Vav3 APN 3 109563094 splice site probably benign
IGL03358:Vav3 APN 3 109647673 missense probably damaging 1.00
PIT4131001:Vav3 UTSW 3 109664435 critical splice donor site probably null
R0511:Vav3 UTSW 3 109664440 splice site probably benign
R0542:Vav3 UTSW 3 109527430 missense probably damaging 1.00
R0630:Vav3 UTSW 3 109424012 missense probably damaging 1.00
R0683:Vav3 UTSW 3 109651813 missense probably benign 0.04
R0833:Vav3 UTSW 3 109647679 missense possibly damaging 0.93
R0836:Vav3 UTSW 3 109647679 missense possibly damaging 0.93
R1561:Vav3 UTSW 3 109494838 critical splice donor site probably null
R1617:Vav3 UTSW 3 109510978 missense probably damaging 1.00
R1760:Vav3 UTSW 3 109341127 missense possibly damaging 0.61
R1834:Vav3 UTSW 3 109506426 missense probably benign 0.06
R1928:Vav3 UTSW 3 109506422 missense possibly damaging 0.94
R2090:Vav3 UTSW 3 109647739 critical splice donor site probably null
R2190:Vav3 UTSW 3 109562814 missense probably damaging 1.00
R2483:Vav3 UTSW 3 109341166 missense probably damaging 1.00
R3124:Vav3 UTSW 3 109628168 critical splice donor site probably null
R3125:Vav3 UTSW 3 109628168 critical splice donor site probably null
R3800:Vav3 UTSW 3 109628039 missense probably benign 0.45
R3919:Vav3 UTSW 3 109527538 missense possibly damaging 0.51
R4693:Vav3 UTSW 3 109563218 splice site probably benign
R4779:Vav3 UTSW 3 109508794 missense possibly damaging 0.88
R5384:Vav3 UTSW 3 109527475 missense possibly damaging 0.92
R5385:Vav3 UTSW 3 109527475 missense possibly damaging 0.92
R5474:Vav3 UTSW 3 109664421 missense probably benign
R5703:Vav3 UTSW 3 109341241 missense probably benign 0.13
R5997:Vav3 UTSW 3 109501461 missense probably damaging 1.00
R6109:Vav3 UTSW 3 109664365 missense probably damaging 1.00
R6110:Vav3 UTSW 3 109664365 missense probably damaging 1.00
R6120:Vav3 UTSW 3 109664365 missense probably damaging 1.00
R6123:Vav3 UTSW 3 109664365 missense probably damaging 1.00
R6124:Vav3 UTSW 3 109664365 missense probably damaging 1.00
R6186:Vav3 UTSW 3 109516067 missense probably damaging 1.00
R6291:Vav3 UTSW 3 109508854 missense possibly damaging 0.82
R6335:Vav3 UTSW 3 109563196 missense probably benign 0.01
R6647:Vav3 UTSW 3 109527416 missense probably benign 0.19
R6849:Vav3 UTSW 3 109521466 missense probably damaging 1.00
R6897:Vav3 UTSW 3 109527494 missense probably damaging 1.00
R7075:Vav3 UTSW 3 109525924 missense possibly damaging 0.47
R7131:Vav3 UTSW 3 109664346 missense probably damaging 1.00
R7328:Vav3 UTSW 3 109503428 missense probably benign 0.10
R7365:Vav3 UTSW 3 109628099 missense possibly damaging 0.67
R8151:Vav3 UTSW 3 109508848 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGGTTTCCAACAGACTGACCGAG -3'
(R):5'- TCCTGATGCTGTCAAAAGCGCC -3'

Sequencing Primer
(F):5'- TGTGACTCACAGTTCTGAGAAG -3'
(R):5'- GCTGTCAAAAGCGCCATCAG -3'
Posted On2013-11-07