Incidental Mutation 'R0940:Sel1l3'
ID81383
Institutional Source Beutler Lab
Gene Symbol Sel1l3
Ensembl Gene ENSMUSG00000029189
Gene Namesel-1 suppressor of lin-12-like 3 (C. elegans)
Synonyms2310045A20Rik
MMRRC Submission 039079-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0940 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location53107083-53213927 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 53144037 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000031090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031090]
Predicted Effect probably benign
Transcript: ENSMUST00000031090
SMART Domains Protein: ENSMUSP00000031090
Gene: ENSMUSG00000029189

DomainStartEndE-ValueType
low complexity region 11 33 N/A INTRINSIC
SEL1 575 609 3.39e1 SMART
SEL1 611 647 1.85e1 SMART
SEL1 694 730 5.27e-5 SMART
SEL1 732 767 2.94e-3 SMART
SEL1 768 800 5.32e-1 SMART
SEL1 801 839 1.23e-5 SMART
SEL1 840 877 8.55e1 SMART
SEL1 952 988 2.56e-3 SMART
low complexity region 1048 1058 N/A INTRINSIC
transmembrane domain 1065 1087 N/A INTRINSIC
low complexity region 1102 1127 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104128
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196435
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.1%
  • 10x: 98.0%
  • 20x: 96.7%
Validation Efficiency 100% (68/68)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810064F22Rik C T 9: 22,208,071 noncoding transcript Het
2610021A01Rik T G 7: 41,626,434 I520M probably damaging Het
Ackr4 A G 9: 104,099,632 F39L probably damaging Het
Adgre5 C T 8: 83,733,497 S92N probably damaging Het
Adrb2 T C 18: 62,179,691 D21G probably benign Het
AI464131 A G 4: 41,497,996 Y545H probably damaging Het
Akr1c6 G A 13: 4,436,373 E60K probably benign Het
Bcl7c T A 7: 127,707,331 N96I possibly damaging Het
Brca1 A T 11: 101,532,143 S106R possibly damaging Het
C6 A T 15: 4,735,235 T138S probably benign Het
Cul3 T C 1: 80,322,847 probably benign Het
Dnah8 T A 17: 30,803,243 M3939K probably damaging Het
Dock4 T A 12: 40,631,627 probably benign Het
Dsc2 T G 18: 20,050,059 T101P probably damaging Het
Dynlt1b T C 17: 6,430,250 probably benign Het
E330013P04Rik A G 19: 60,161,922 noncoding transcript Het
Fam160a1 A G 3: 85,665,490 V952A possibly damaging Het
Fggy A G 4: 95,697,001 E39G probably benign Het
Fmo6 A T 1: 162,926,226 C116S probably benign Het
Gadd45a A G 6: 67,036,829 I44T possibly damaging Het
Gmps A G 3: 63,976,322 probably benign Het
Gnmt A G 17: 46,726,345 L171P probably damaging Het
Hnrnpm G A 17: 33,650,002 R523C probably damaging Het
Inpp5a T C 7: 139,525,738 Y202H probably damaging Het
Kank3 C T 17: 33,817,476 S106F probably damaging Het
Lmcd1 A G 6: 112,328,697 D253G probably benign Het
Lrrk2 A T 15: 91,729,081 I803F possibly damaging Het
Mybpc2 T C 7: 44,506,887 K834R probably benign Het
Mycbp2 A T 14: 103,262,693 probably benign Het
Myh4 A T 11: 67,242,863 N243Y probably damaging Het
Nfatc1 C T 18: 80,635,895 M759I probably benign Het
Nipal4 A G 11: 46,150,312 I352T possibly damaging Het
Nomo1 A G 7: 46,033,905 E25G possibly damaging Het
Olfr1221 T A 2: 89,112,075 I146L probably benign Het
Olfr128 A G 17: 37,923,700 I45V probably damaging Het
Olfr1408 A G 1: 173,130,453 S255P probably benign Het
Olfr392 T C 11: 73,814,224 N286S probably damaging Het
Olfr490 T C 7: 108,287,057 D23G probably benign Het
Olfr525 T C 7: 140,323,152 I151T probably benign Het
Pabpn1l A G 8: 122,622,444 V78A probably benign Het
Pde6b T A 5: 108,420,337 I327N possibly damaging Het
Phrf1 T C 7: 141,254,855 probably benign Het
Pkm C T 9: 59,668,535 probably benign Het
Plxna2 G A 1: 194,800,555 V1519I probably benign Het
Ppp2cb T C 8: 33,615,661 probably null Het
Prickle2 A G 6: 92,411,003 Y473H probably benign Het
Prpf3 A G 3: 95,844,223 W389R probably damaging Het
Psme4 G A 11: 30,815,264 E544K possibly damaging Het
Relb A T 7: 19,611,842 D395E probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf213 A G 11: 119,416,563 N683S probably benign Het
Rtel1 T C 2: 181,322,803 C102R probably benign Het
Slc8a2 A G 7: 16,144,962 T458A probably benign Het
Smc3 T A 19: 53,640,909 M931K probably benign Het
Sorbs2 T C 8: 45,796,502 V795A probably benign Het
Tgm3 A G 2: 130,012,406 S2G probably benign Het
Tpbpa T C 13: 60,940,053 T75A probably damaging Het
Trub1 A G 19: 57,485,063 probably benign Het
Uggt2 A G 14: 119,091,192 probably null Het
Ugt2a3 A G 5: 87,327,206 V393A possibly damaging Het
Vav3 T A 3: 109,562,835 M532K possibly damaging Het
Zfp616 A T 11: 74,085,024 K706N probably damaging Het
Zkscan1 T C 5: 138,093,170 F55S probably damaging Het
Other mutations in Sel1l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Sel1l3 APN 5 53116333 missense probably damaging 0.96
IGL01585:Sel1l3 APN 5 53154236 missense probably damaging 0.99
IGL01717:Sel1l3 APN 5 53200168 missense probably damaging 0.99
IGL01771:Sel1l3 APN 5 53121841 missense probably damaging 0.99
IGL01926:Sel1l3 APN 5 53200143 missense probably benign 0.26
IGL01963:Sel1l3 APN 5 53200338 missense probably damaging 0.99
IGL02000:Sel1l3 APN 5 53145493 missense probably damaging 1.00
IGL02132:Sel1l3 APN 5 53170405 missense possibly damaging 0.89
IGL02198:Sel1l3 APN 5 53139799 splice site probably benign
IGL02930:Sel1l3 APN 5 53123217 missense possibly damaging 0.65
IGL03146:Sel1l3 APN 5 53154243 missense probably benign 0.00
IGL03175:Sel1l3 APN 5 53121857 missense probably damaging 1.00
R0083:Sel1l3 UTSW 5 53137902 missense possibly damaging 0.79
R0108:Sel1l3 UTSW 5 53137902 missense possibly damaging 0.79
R0108:Sel1l3 UTSW 5 53137902 missense possibly damaging 0.79
R1027:Sel1l3 UTSW 5 53145478 missense possibly damaging 0.68
R1117:Sel1l3 UTSW 5 53172607 missense probably benign 0.00
R1145:Sel1l3 UTSW 5 53131827 missense probably damaging 0.99
R1145:Sel1l3 UTSW 5 53131827 missense probably damaging 0.99
R1146:Sel1l3 UTSW 5 53117103 missense possibly damaging 0.79
R1146:Sel1l3 UTSW 5 53117103 missense possibly damaging 0.79
R1345:Sel1l3 UTSW 5 53200217 missense possibly damaging 0.86
R1370:Sel1l3 UTSW 5 53200217 missense possibly damaging 0.86
R1503:Sel1l3 UTSW 5 53137929 missense probably damaging 0.98
R1747:Sel1l3 UTSW 5 53145545 missense possibly damaging 0.91
R1764:Sel1l3 UTSW 5 53170447 nonsense probably null
R2872:Sel1l3 UTSW 5 53137883 nonsense probably null
R2872:Sel1l3 UTSW 5 53137883 nonsense probably null
R3434:Sel1l3 UTSW 5 53117090 missense probably benign 0.44
R4043:Sel1l3 UTSW 5 53188054 nonsense probably null
R4074:Sel1l3 UTSW 5 53154287 missense probably damaging 0.99
R4727:Sel1l3 UTSW 5 53144183 critical splice acceptor site probably null
R4788:Sel1l3 UTSW 5 53131833 missense probably benign 0.41
R4900:Sel1l3 UTSW 5 53131842 missense probably damaging 1.00
R5000:Sel1l3 UTSW 5 53200434 missense probably damaging 0.97
R5090:Sel1l3 UTSW 5 53200046 missense probably benign 0.03
R5330:Sel1l3 UTSW 5 53186009 missense possibly damaging 0.80
R5456:Sel1l3 UTSW 5 53200036 missense probably benign 0.13
R5544:Sel1l3 UTSW 5 53200302 missense probably damaging 0.98
R5848:Sel1l3 UTSW 5 53184808 missense possibly damaging 0.91
R6132:Sel1l3 UTSW 5 53200189 missense possibly damaging 0.77
R6188:Sel1l3 UTSW 5 53155719 missense possibly damaging 0.70
R6622:Sel1l3 UTSW 5 53139860 missense probably damaging 0.98
R7015:Sel1l3 UTSW 5 53172574 missense probably benign 0.03
R7200:Sel1l3 UTSW 5 53144109 missense probably benign 0.22
R7271:Sel1l3 UTSW 5 53116362 missense probably damaging 0.98
R7378:Sel1l3 UTSW 5 53116409 missense probably benign 0.02
R7479:Sel1l3 UTSW 5 53117120 missense probably damaging 0.99
R7563:Sel1l3 UTSW 5 53185984 missense probably damaging 1.00
R7643:Sel1l3 UTSW 5 53123162 splice site probably null
R7741:Sel1l3 UTSW 5 53200251 missense probably damaging 1.00
R7743:Sel1l3 UTSW 5 53135885 missense probably benign 0.07
R7861:Sel1l3 UTSW 5 53144064 missense probably damaging 0.96
R7904:Sel1l3 UTSW 5 53139824 missense probably benign 0.24
R7944:Sel1l3 UTSW 5 53144064 missense probably damaging 0.96
R7987:Sel1l3 UTSW 5 53139824 missense probably benign 0.24
Z1088:Sel1l3 UTSW 5 53116196 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGAACCAGTGACAAACGTGCGG -3'
(R):5'- AGCAACGATTGGCTCAGATGCTC -3'

Sequencing Primer
(F):5'- GTGTCACCTTCAGAATGTCACAG -3'
(R):5'- CTCAGATGCTCTTCTGGGGAC -3'
Posted On2013-11-07