Incidental Mutation 'R0940:Pde6b'
Institutional Source Beutler Lab
Gene Symbol Pde6b
Ensembl Gene ENSMUSG00000029491
Gene Namephosphodiesterase 6B, cGMP, rod receptor, beta polypeptide
Synonymsrd10, Pdeb, rd, rd1, r
MMRRC Submission 039079-MU
Accession Numbers

Genbank: NM_008806; MGI: 97525

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0940 (G1)
Quality Score225
Status Validated
Chromosomal Location108388391-108432397 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108420337 bp
Amino Acid Change Isoleucine to Asparagine at position 327 (I327N)
Ref Sequence ENSEMBL: ENSMUSP00000031456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031456]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031456
AA Change: I327N

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000031456
Gene: ENSMUSG00000029491
AA Change: I327N

GAF 71 230 1.29e-27 SMART
GAF 252 439 5.76e-25 SMART
Blast:HDc 484 538 1e-24 BLAST
HDc 554 732 1.25e-9 SMART
Blast:HDc 757 792 8e-13 BLAST
low complexity region 813 837 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134865
Meta Mutation Damage Score 0.9058 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.1%
  • 10x: 98.0%
  • 20x: 96.7%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Photon absorption triggers a signaling cascade in rod photoreceptors that activates cGMP phosphodiesterase (PDE), resulting in the rapid hydrolysis of cGMP, closure of cGMP-gated cation channels, and hyperpolarization of the cell. PDE is a peripheral membrane heterotrimeric enzyme made up of alpha, beta, and gamma subunits. This gene encodes the beta subunit. Mutations in this gene result in retinitis pigmentosa and autosomal dominant congenital stationary night blindness. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygotes for the rd1 mutation have severe retinal degeneration and vision loss. Rod cells are lost by 35 days of age; cone cells degenerate slower and some light sensitivity persists. Other allelic mutations produce similar or milder phenotypes. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, knock-out(1) Targeted, other(1) Spontaneous(2) Chemically induced(9)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810064F22Rik C T 9: 22,208,071 noncoding transcript Het
2610021A01Rik T G 7: 41,626,434 I520M probably damaging Het
Ackr4 A G 9: 104,099,632 F39L probably damaging Het
Adgre5 C T 8: 83,733,497 S92N probably damaging Het
Adrb2 T C 18: 62,179,691 D21G probably benign Het
AI464131 A G 4: 41,497,996 Y545H probably damaging Het
Akr1c6 G A 13: 4,436,373 E60K probably benign Het
Bcl7c T A 7: 127,707,331 N96I possibly damaging Het
Brca1 A T 11: 101,532,143 S106R possibly damaging Het
C6 A T 15: 4,735,235 T138S probably benign Het
Cul3 T C 1: 80,322,847 probably benign Het
Dnah8 T A 17: 30,803,243 M3939K probably damaging Het
Dock4 T A 12: 40,631,627 probably benign Het
Dsc2 T G 18: 20,050,059 T101P probably damaging Het
Dynlt1b T C 17: 6,430,250 probably benign Het
E330013P04Rik A G 19: 60,161,922 noncoding transcript Het
Fam160a1 A G 3: 85,665,490 V952A possibly damaging Het
Fggy A G 4: 95,697,001 E39G probably benign Het
Fmo6 A T 1: 162,926,226 C116S probably benign Het
Gadd45a A G 6: 67,036,829 I44T possibly damaging Het
Gmps A G 3: 63,976,322 probably benign Het
Gnmt A G 17: 46,726,345 L171P probably damaging Het
Hnrnpm G A 17: 33,650,002 R523C probably damaging Het
Inpp5a T C 7: 139,525,738 Y202H probably damaging Het
Kank3 C T 17: 33,817,476 S106F probably damaging Het
Lmcd1 A G 6: 112,328,697 D253G probably benign Het
Lrrk2 A T 15: 91,729,081 I803F possibly damaging Het
Mybpc2 T C 7: 44,506,887 K834R probably benign Het
Mycbp2 A T 14: 103,262,693 probably benign Het
Myh4 A T 11: 67,242,863 N243Y probably damaging Het
Nfatc1 C T 18: 80,635,895 M759I probably benign Het
Nipal4 A G 11: 46,150,312 I352T possibly damaging Het
Nomo1 A G 7: 46,033,905 E25G possibly damaging Het
Olfr1221 T A 2: 89,112,075 I146L probably benign Het
Olfr128 A G 17: 37,923,700 I45V probably damaging Het
Olfr1408 A G 1: 173,130,453 S255P probably benign Het
Olfr392 T C 11: 73,814,224 N286S probably damaging Het
Olfr490 T C 7: 108,287,057 D23G probably benign Het
Olfr525 T C 7: 140,323,152 I151T probably benign Het
Pabpn1l A G 8: 122,622,444 V78A probably benign Het
Phrf1 T C 7: 141,254,855 probably benign Het
Pkm C T 9: 59,668,535 probably benign Het
Plxna2 G A 1: 194,800,555 V1519I probably benign Het
Ppp2cb T C 8: 33,615,661 probably null Het
Prickle2 A G 6: 92,411,003 Y473H probably benign Het
Prpf3 A G 3: 95,844,223 W389R probably damaging Het
Psme4 G A 11: 30,815,264 E544K possibly damaging Het
Relb A T 7: 19,611,842 D395E probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf213 A G 11: 119,416,563 N683S probably benign Het
Rtel1 T C 2: 181,322,803 C102R probably benign Het
Sel1l3 C T 5: 53,144,037 probably benign Het
Slc8a2 A G 7: 16,144,962 T458A probably benign Het
Smc3 T A 19: 53,640,909 M931K probably benign Het
Sorbs2 T C 8: 45,796,502 V795A probably benign Het
Tgm3 A G 2: 130,012,406 S2G probably benign Het
Tpbpa T C 13: 60,940,053 T75A probably damaging Het
Trub1 A G 19: 57,485,063 probably benign Het
Uggt2 A G 14: 119,091,192 probably null Het
Ugt2a3 A G 5: 87,327,206 V393A possibly damaging Het
Vav3 T A 3: 109,562,835 M532K possibly damaging Het
Zfp616 A T 11: 74,085,024 K706N probably damaging Het
Zkscan1 T C 5: 138,093,170 F55S probably damaging Het
Other mutations in Pde6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Pde6b APN 5 108426571 splice site probably benign
IGL01071:Pde6b APN 5 108419715 nonsense probably null
IGL01335:Pde6b APN 5 108423513 missense probably benign 0.03
IGL01611:Pde6b APN 5 108403396 missense possibly damaging 0.90
IGL01881:Pde6b APN 5 108421500 missense probably benign 0.01
IGL01941:Pde6b APN 5 108423036 missense probably benign 0.11
IGL02616:Pde6b APN 5 108431541 missense probably benign 0.05
IGL02657:Pde6b APN 5 108420276 splice site probably benign
IGL03217:Pde6b APN 5 108419566 missense probably damaging 1.00
Bemr28 UTSW 5 unclassified
D4043:Pde6b UTSW 5 108425356 nonsense probably null
N/A:Pde6b UTSW 5 108429103 unclassified probably benign
PIT4362001:Pde6b UTSW 5 108423585 critical splice donor site probably null
PIT4581001:Pde6b UTSW 5 108428508 missense probably benign 0.01
R0963:Pde6b UTSW 5 108430668 missense probably benign
R1738:Pde6b UTSW 5 108430559 nonsense probably null
R1753:Pde6b UTSW 5 108388691 nonsense probably null
R1801:Pde6b UTSW 5 108427847 missense possibly damaging 0.51
R1913:Pde6b UTSW 5 108427190 missense probably benign 0.05
R2131:Pde6b UTSW 5 108428203 missense probably damaging 1.00
R2282:Pde6b UTSW 5 108423586 splice site probably null
R3713:Pde6b UTSW 5 108423062 missense probably damaging 1.00
R4385:Pde6b UTSW 5 108427642 missense probably benign 0.08
R4562:Pde6b UTSW 5 108403368 missense probably benign 0.23
R4582:Pde6b UTSW 5 108425231 critical splice acceptor site probably null
R4939:Pde6b UTSW 5 108421497 missense probably benign 0.01
R4950:Pde6b UTSW 5 108430703 missense probably benign 0.16
R4972:Pde6b UTSW 5 108425264 missense probably benign 0.00
R4983:Pde6b UTSW 5 108425330 missense probably benign 0.21
R5056:Pde6b UTSW 5 108423491 nonsense probably null
R5514:Pde6b UTSW 5 108423451 missense probably benign 0.06
R5528:Pde6b UTSW 5 108423558 missense probably benign 0.04
R5937:Pde6b UTSW 5 108424327 missense probably benign 0.00
R6556:Pde6b UTSW 5 108421501 missense possibly damaging 0.56
R6826:Pde6b UTSW 5 108430592 nonsense probably null
R6884:Pde6b UTSW 5 108388708 missense probably damaging 0.99
R7213:Pde6b UTSW 5 108404090 missense probably damaging 1.00
R7444:Pde6b UTSW 5 108427142 nonsense probably null
R7690:Pde6b UTSW 5 108419518 missense probably damaging 1.00
R7909:Pde6b UTSW 5 108403422 missense probably benign 0.01
R7937:Pde6b UTSW 5 108419773 critical splice donor site probably null
R8049:Pde6b UTSW 5 108425252 missense probably benign 0.04
R8087:Pde6b UTSW 5 108388462 missense probably benign 0.00
R8698:Pde6b UTSW 5 108428239 missense possibly damaging 0.87
R8822:Pde6b UTSW 5 108403462 missense probably benign 0.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- gagggagagggagagagag -3'
(R):5'- aattcaattcccagcaaccac -3'
Posted On2013-11-07