Incidental Mutation 'R0963:Jag2'
ID81392
Institutional Source Beutler Lab
Gene Symbol Jag2
Ensembl Gene ENSMUSG00000002799
Gene Namejagged 2
SynonymsSerh, D12Ggc2e
MMRRC Submission 039092-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0963 (G1)
Quality Score178
Status Not validated
Chromosome12
Chromosomal Location112907819-112929776 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 112915314 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 496 (E496K)
Ref Sequence ENSEMBL: ENSMUSP00000075224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075827]
Predicted Effect probably damaging
Transcript: ENSMUST00000075827
AA Change: E496K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075224
Gene: ENSMUSG00000002799
AA Change: E496K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:MNNL 26 105 4.2e-31 PFAM
low complexity region 108 123 N/A INTRINSIC
DSL 178 240 1.48e-36 SMART
EGF_like 244 274 7.23e1 SMART
EGF 275 305 4.56e0 SMART
EGF_CA 307 345 8.5e-9 SMART
EGF 350 383 4e-5 SMART
EGF_CA 385 421 5.39e-11 SMART
EGF_CA 423 459 3.51e-10 SMART
EGF_CA 461 496 1.01e-10 SMART
EGF_CA 498 534 1.17e-6 SMART
EGF_CA 536 572 6.35e-8 SMART
EGF 588 634 7.53e-1 SMART
EGF_CA 636 672 2.89e-11 SMART
EGF 677 710 3.68e-4 SMART
EGF 715 748 1.32e-5 SMART
EGF 754 787 1.34e-6 SMART
EGF_CA 789 825 2.58e-8 SMART
EGF_CA 827 863 7.23e-12 SMART
VWC 872 949 1.3e-1 SMART
low complexity region 1002 1035 N/A INTRINSIC
transmembrane domain 1085 1107 N/A INTRINSIC
low complexity region 1109 1119 N/A INTRINSIC
low complexity region 1170 1199 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220771
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220855
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221320
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221647
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221696
Predicted Effect unknown
Transcript: ENSMUST00000223140
AA Change: E61K
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223304
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Notch signaling pathway is an intercellular signaling mechanism that is essential for proper embryonic development. Members of the Notch gene family encode transmembrane receptors that are critical for various cell fate decisions. The protein encoded by this gene is one of several ligands that activate Notch and related receptors. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation die perinatally with craniofacial defects, fused digits, and increased numbers of sensory hair cells in the cochlea. Homozygotes for a spontaneous mutation exhibit fused digits and sometimes tail kinks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025F22Rik T C 19: 11,141,557 T63A possibly damaging Het
Adarb2 A G 13: 8,672,415 D369G probably damaging Het
Adcy7 T C 8: 88,312,265 V303A probably damaging Het
Afap1l1 A T 18: 61,736,930 Y610N probably damaging Het
Agr3 T A 12: 35,934,434 H53Q probably benign Het
Akr1d1 A G 6: 37,530,274 I10M probably damaging Het
Atp4b G T 8: 13,390,014 H111N probably benign Het
Bbs7 G T 3: 36,613,263 A8E probably benign Het
Bsn C T 9: 108,111,807 V2249M possibly damaging Het
Cpt1a T C 19: 3,381,634 S685P probably damaging Het
Dhx57 A T 17: 80,275,527 H163Q probably benign Het
Duox2 A C 2: 122,287,172 C894G probably benign Het
Ecm1 T C 3: 95,736,588 T209A possibly damaging Het
Glo1 T C 17: 30,600,111 N79S probably benign Het
Gm13078 T A 4: 143,727,108 I262N possibly damaging Het
Gm4763 A T 7: 24,723,622 D90E probably benign Het
Htra1 T A 7: 130,982,279 M388K possibly damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kcnh2 C T 5: 24,322,672 R894H probably damaging Het
Khdc1c A G 1: 21,369,609 N128S probably benign Het
Lamc1 T C 1: 153,243,386 N829S probably benign Het
Leprotl1 T C 8: 34,139,035 Y33C probably damaging Het
Map3k3 T A 11: 106,123,792 S130T probably benign Het
Mip C T 10: 128,225,985 A35V probably benign Het
Myh15 A G 16: 49,132,149 R861G probably damaging Het
Myom1 A C 17: 71,077,767 I718L possibly damaging Het
Naip6 C T 13: 100,316,475 R26H probably benign Het
Olfr677 G A 7: 105,056,972 C242Y probably damaging Het
Pde6b A G 5: 108,430,668 E824G probably benign Het
Rbm19 T G 5: 120,130,734 S476A possibly damaging Het
Rpl39l T A 16: 10,174,298 probably null Het
Sec24b A G 3: 130,040,905 S79P probably benign Het
Slc15a2 G A 16: 36,774,573 A146V probably damaging Het
Slmap T C 14: 26,468,520 Y161C probably damaging Het
Smc4 T A 3: 69,025,926 C652S probably damaging Het
Stab1 A G 14: 31,147,274 I1499T probably damaging Het
Tnnt1 A G 7: 4,507,595 L209P probably damaging Het
Trim52 T G 14: 106,107,539 S210R probably benign Het
Tsc22d1 T A 14: 76,418,599 N82K possibly damaging Het
Wdr75 T C 1: 45,817,310 Y498H probably benign Het
Zfp955a C T 17: 33,243,752 S56N probably benign Het
Other mutations in Jag2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Jag2 APN 12 112912718 missense probably benign 0.20
IGL00954:Jag2 APN 12 112920406 missense possibly damaging 0.50
IGL01532:Jag2 APN 12 112914363 missense probably damaging 0.98
IGL01646:Jag2 APN 12 112916349 missense possibly damaging 0.65
IGL02243:Jag2 APN 12 112916345 missense possibly damaging 0.94
IGL02447:Jag2 APN 12 112912612 missense probably damaging 1.00
IGL02458:Jag2 APN 12 112915993 missense probably damaging 0.98
IGL02516:Jag2 APN 12 112910566 missense probably damaging 1.00
IGL02574:Jag2 APN 12 112915511 missense probably benign 0.32
IGL02629:Jag2 APN 12 112914514 splice site probably benign
IGL02873:Jag2 APN 12 112910502 missense probably benign 0.00
IGL03087:Jag2 APN 12 112913948 missense possibly damaging 0.60
Jaguarundi UTSW 12 112915469 critical splice donor site probably null
R0068:Jag2 UTSW 12 112915193 splice site probably benign
R0310:Jag2 UTSW 12 112913377 unclassified probably benign
R1188:Jag2 UTSW 12 112920121 nonsense probably null
R1256:Jag2 UTSW 12 112914419 missense possibly damaging 0.50
R1298:Jag2 UTSW 12 112916319 unclassified probably benign
R1317:Jag2 UTSW 12 112914501 missense probably benign
R2079:Jag2 UTSW 12 112920377 missense probably damaging 1.00
R2345:Jag2 UTSW 12 112909064 missense probably damaging 1.00
R4654:Jag2 UTSW 12 112913646 missense probably benign 0.13
R4782:Jag2 UTSW 12 112914249 missense probably benign
R4798:Jag2 UTSW 12 112916632 missense probably benign 0.01
R5242:Jag2 UTSW 12 112916866 missense probably damaging 0.97
R5350:Jag2 UTSW 12 112908922 missense possibly damaging 0.77
R5364:Jag2 UTSW 12 112910534 missense probably damaging 1.00
R6129:Jag2 UTSW 12 112920349 nonsense probably null
R6362:Jag2 UTSW 12 112920122 missense probably damaging 0.97
R6376:Jag2 UTSW 12 112909329 missense probably benign 0.00
R6819:Jag2 UTSW 12 112910541 missense probably damaging 1.00
R6844:Jag2 UTSW 12 112916714 missense probably damaging 1.00
R6968:Jag2 UTSW 12 112914258 missense probably benign 0.10
R7514:Jag2 UTSW 12 112929052 missense probably benign 0.19
R7663:Jag2 UTSW 12 112913666 missense probably damaging 1.00
R7730:Jag2 UTSW 12 112922041 missense probably damaging 1.00
R7754:Jag2 UTSW 12 112915469 critical splice donor site probably null
R7828:Jag2 UTSW 12 112913180 missense probably benign 0.19
R7874:Jag2 UTSW 12 112915946 missense probably damaging 0.99
R8075:Jag2 UTSW 12 112915274 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TTGTTGAGACAAGGGACAAGCCTG -3'
(R):5'- TGGAAGGGCATCAACTGCCAAATC -3'

Sequencing Primer
(F):5'- CAAGCCTGGCTTTGGTGAC -3'
(R):5'- CTGCCAAATCAGTCAGTATGGG -3'
Posted On2013-11-07