Incidental Mutation 'R0963:Jag2'
ID 81392
Institutional Source Beutler Lab
Gene Symbol Jag2
Ensembl Gene ENSMUSG00000002799
Gene Name jagged 2
Synonyms D12Ggc2e, Serh
MMRRC Submission 039092-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0963 (G1)
Quality Score 178
Status Not validated
Chromosome 12
Chromosomal Location 112871439-112893396 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 112878934 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 496 (E496K)
Ref Sequence ENSEMBL: ENSMUSP00000075224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075827]
AlphaFold Q9QYE5
Predicted Effect probably damaging
Transcript: ENSMUST00000075827
AA Change: E496K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075224
Gene: ENSMUSG00000002799
AA Change: E496K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:MNNL 26 105 4.2e-31 PFAM
low complexity region 108 123 N/A INTRINSIC
DSL 178 240 1.48e-36 SMART
EGF_like 244 274 7.23e1 SMART
EGF 275 305 4.56e0 SMART
EGF_CA 307 345 8.5e-9 SMART
EGF 350 383 4e-5 SMART
EGF_CA 385 421 5.39e-11 SMART
EGF_CA 423 459 3.51e-10 SMART
EGF_CA 461 496 1.01e-10 SMART
EGF_CA 498 534 1.17e-6 SMART
EGF_CA 536 572 6.35e-8 SMART
EGF 588 634 7.53e-1 SMART
EGF_CA 636 672 2.89e-11 SMART
EGF 677 710 3.68e-4 SMART
EGF 715 748 1.32e-5 SMART
EGF 754 787 1.34e-6 SMART
EGF_CA 789 825 2.58e-8 SMART
EGF_CA 827 863 7.23e-12 SMART
VWC 872 949 1.3e-1 SMART
low complexity region 1002 1035 N/A INTRINSIC
transmembrane domain 1085 1107 N/A INTRINSIC
low complexity region 1109 1119 N/A INTRINSIC
low complexity region 1170 1199 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220771
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220855
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221320
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221647
Predicted Effect unknown
Transcript: ENSMUST00000223140
AA Change: E61K
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221696
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223304
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Notch signaling pathway is an intercellular signaling mechanism that is essential for proper embryonic development. Members of the Notch gene family encode transmembrane receptors that are critical for various cell fate decisions. The protein encoded by this gene is one of several ligands that activate Notch and related receptors. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation die perinatally with craniofacial defects, fused digits, and increased numbers of sensory hair cells in the cochlea. Homozygotes for a spontaneous mutation exhibit fused digits and sometimes tail kinks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb2 A G 13: 8,722,451 (GRCm39) D369G probably damaging Het
Adcy7 T C 8: 89,038,893 (GRCm39) V303A probably damaging Het
Afap1l1 A T 18: 61,870,001 (GRCm39) Y610N probably damaging Het
Agr3 T A 12: 35,984,433 (GRCm39) H53Q probably benign Het
Akr1d1 A G 6: 37,507,209 (GRCm39) I10M probably damaging Het
Atp4b G T 8: 13,440,014 (GRCm39) H111N probably benign Het
Bbs7 G T 3: 36,667,412 (GRCm39) A8E probably benign Het
Bsn C T 9: 107,989,006 (GRCm39) V2249M possibly damaging Het
Cpt1a T C 19: 3,431,634 (GRCm39) S685P probably damaging Het
Dhx57 A T 17: 80,582,956 (GRCm39) H163Q probably benign Het
Duox2 A C 2: 122,117,653 (GRCm39) C894G probably benign Het
Ecm1 T C 3: 95,643,900 (GRCm39) T209A possibly damaging Het
Glo1 T C 17: 30,819,085 (GRCm39) N79S probably benign Het
Htra1 T A 7: 130,584,009 (GRCm39) M388K possibly damaging Het
Iqca1 C A 1: 90,070,453 (GRCm39) G133V probably null Het
Kcnh2 C T 5: 24,527,670 (GRCm39) R894H probably damaging Het
Khdc1c A G 1: 21,439,833 (GRCm39) N128S probably benign Het
Lamc1 T C 1: 153,119,132 (GRCm39) N829S probably benign Het
Leprotl1 T C 8: 34,606,189 (GRCm39) Y33C probably damaging Het
Lypd11 A T 7: 24,423,047 (GRCm39) D90E probably benign Het
Map3k3 T A 11: 106,014,618 (GRCm39) S130T probably benign Het
Mip C T 10: 128,061,854 (GRCm39) A35V probably benign Het
Ms4a19 T C 19: 11,118,921 (GRCm39) T63A possibly damaging Het
Myh15 A G 16: 48,952,512 (GRCm39) R861G probably damaging Het
Myom1 A C 17: 71,384,762 (GRCm39) I718L possibly damaging Het
Naip6 C T 13: 100,452,983 (GRCm39) R26H probably benign Het
Or52e4 G A 7: 104,706,179 (GRCm39) C242Y probably damaging Het
Pde6b A G 5: 108,578,534 (GRCm39) E824G probably benign Het
Pramel24 T A 4: 143,453,678 (GRCm39) I262N possibly damaging Het
Rbm19 T G 5: 120,268,799 (GRCm39) S476A possibly damaging Het
Rpl39l T A 16: 9,992,162 (GRCm39) probably null Het
Sec24b A G 3: 129,834,554 (GRCm39) S79P probably benign Het
Slc15a2 G A 16: 36,594,935 (GRCm39) A146V probably damaging Het
Slmap T C 14: 26,189,675 (GRCm39) Y161C probably damaging Het
Smc4 T A 3: 68,933,259 (GRCm39) C652S probably damaging Het
Stab1 A G 14: 30,869,231 (GRCm39) I1499T probably damaging Het
Tnnt1 A G 7: 4,510,594 (GRCm39) L209P probably damaging Het
Trim52 T G 14: 106,344,973 (GRCm39) S210R probably benign Het
Tsc22d1 T A 14: 76,656,039 (GRCm39) N82K possibly damaging Het
Wdr75 T C 1: 45,856,470 (GRCm39) Y498H probably benign Het
Zfp955a C T 17: 33,462,726 (GRCm39) S56N probably benign Het
Other mutations in Jag2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Jag2 APN 12 112,876,338 (GRCm39) missense probably benign 0.20
IGL00954:Jag2 APN 12 112,884,026 (GRCm39) missense possibly damaging 0.50
IGL01532:Jag2 APN 12 112,877,983 (GRCm39) missense probably damaging 0.98
IGL01646:Jag2 APN 12 112,879,969 (GRCm39) missense possibly damaging 0.65
IGL02243:Jag2 APN 12 112,879,965 (GRCm39) missense possibly damaging 0.94
IGL02447:Jag2 APN 12 112,876,232 (GRCm39) missense probably damaging 1.00
IGL02458:Jag2 APN 12 112,879,613 (GRCm39) missense probably damaging 0.98
IGL02516:Jag2 APN 12 112,874,186 (GRCm39) missense probably damaging 1.00
IGL02574:Jag2 APN 12 112,879,131 (GRCm39) missense probably benign 0.32
IGL02629:Jag2 APN 12 112,878,134 (GRCm39) splice site probably benign
IGL02873:Jag2 APN 12 112,874,122 (GRCm39) missense probably benign 0.00
IGL03087:Jag2 APN 12 112,877,568 (GRCm39) missense possibly damaging 0.60
Jaguarundi UTSW 12 112,879,089 (GRCm39) critical splice donor site probably null
R0068:Jag2 UTSW 12 112,878,813 (GRCm39) splice site probably benign
R0310:Jag2 UTSW 12 112,876,997 (GRCm39) unclassified probably benign
R1188:Jag2 UTSW 12 112,883,741 (GRCm39) nonsense probably null
R1256:Jag2 UTSW 12 112,878,039 (GRCm39) missense possibly damaging 0.50
R1298:Jag2 UTSW 12 112,879,939 (GRCm39) unclassified probably benign
R1317:Jag2 UTSW 12 112,878,121 (GRCm39) missense probably benign
R2079:Jag2 UTSW 12 112,883,997 (GRCm39) missense probably damaging 1.00
R2345:Jag2 UTSW 12 112,872,684 (GRCm39) missense probably damaging 1.00
R4654:Jag2 UTSW 12 112,877,266 (GRCm39) missense probably benign 0.13
R4782:Jag2 UTSW 12 112,877,869 (GRCm39) missense probably benign
R4798:Jag2 UTSW 12 112,880,252 (GRCm39) missense probably benign 0.01
R5242:Jag2 UTSW 12 112,880,486 (GRCm39) missense probably damaging 0.97
R5350:Jag2 UTSW 12 112,872,542 (GRCm39) missense possibly damaging 0.77
R5364:Jag2 UTSW 12 112,874,154 (GRCm39) missense probably damaging 1.00
R6129:Jag2 UTSW 12 112,883,969 (GRCm39) nonsense probably null
R6362:Jag2 UTSW 12 112,883,742 (GRCm39) missense probably damaging 0.97
R6376:Jag2 UTSW 12 112,872,949 (GRCm39) missense probably benign 0.00
R6819:Jag2 UTSW 12 112,874,161 (GRCm39) missense probably damaging 1.00
R6844:Jag2 UTSW 12 112,880,334 (GRCm39) missense probably damaging 1.00
R6968:Jag2 UTSW 12 112,877,878 (GRCm39) missense probably benign 0.10
R7514:Jag2 UTSW 12 112,892,672 (GRCm39) missense probably benign 0.19
R7663:Jag2 UTSW 12 112,877,286 (GRCm39) missense probably damaging 1.00
R7730:Jag2 UTSW 12 112,885,661 (GRCm39) missense probably damaging 1.00
R7754:Jag2 UTSW 12 112,879,089 (GRCm39) critical splice donor site probably null
R7828:Jag2 UTSW 12 112,876,800 (GRCm39) missense probably benign 0.19
R7874:Jag2 UTSW 12 112,879,566 (GRCm39) missense probably damaging 0.99
R8075:Jag2 UTSW 12 112,878,894 (GRCm39) missense probably benign 0.05
R8845:Jag2 UTSW 12 112,883,714 (GRCm39) missense probably damaging 1.00
R8876:Jag2 UTSW 12 112,873,257 (GRCm39) missense probably benign 0.00
R9117:Jag2 UTSW 12 112,877,279 (GRCm39) nonsense probably null
R9400:Jag2 UTSW 12 112,875,608 (GRCm39) nonsense probably null
R9673:Jag2 UTSW 12 112,875,416 (GRCm39) nonsense probably null
R9688:Jag2 UTSW 12 112,872,564 (GRCm39) missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TTGTTGAGACAAGGGACAAGCCTG -3'
(R):5'- TGGAAGGGCATCAACTGCCAAATC -3'

Sequencing Primer
(F):5'- CAAGCCTGGCTTTGGTGAC -3'
(R):5'- CTGCCAAATCAGTCAGTATGGG -3'
Posted On 2013-11-07