Incidental Mutation 'R0963:Naip6'
Institutional Source Beutler Lab
Gene Symbol Naip6
Ensembl Gene ENSMUSG00000078942
Gene NameNLR family, apoptosis inhibitory protein 6
SynonymsBirc1f, Naip-rs4, Naip-rs4A
MMRRC Submission 039092-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R0963 (G1)
Quality Score225
Status Not validated
Chromosomal Location100281121-100317674 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 100316475 bp
Amino Acid Change Arginine to Histidine at position 26 (R26H)
Ref Sequence ENSEMBL: ENSMUSP00000112867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042220] [ENSMUST00000118574]
Predicted Effect probably benign
Transcript: ENSMUST00000042220
AA Change: R26H

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000041766
Gene: ENSMUSG00000078942
AA Change: R26H

BIR 58 129 6.21e-20 SMART
BIR 157 229 8.04e-37 SMART
BIR 276 347 5.19e-31 SMART
Pfam:NACHT 464 618 7.6e-37 PFAM
low complexity region 851 862 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118574
AA Change: R26H

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000112867
Gene: ENSMUSG00000078942
AA Change: R26H

BIR 58 129 6.21e-20 SMART
BIR 157 229 8.04e-37 SMART
BIR 276 347 5.19e-31 SMART
Pfam:NACHT 464 618 2.5e-35 PFAM
low complexity region 851 862 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: Closest sequence match is AF381772. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025F22Rik T C 19: 11,141,557 T63A possibly damaging Het
Adarb2 A G 13: 8,672,415 D369G probably damaging Het
Adcy7 T C 8: 88,312,265 V303A probably damaging Het
Afap1l1 A T 18: 61,736,930 Y610N probably damaging Het
Agr3 T A 12: 35,934,434 H53Q probably benign Het
Akr1d1 A G 6: 37,530,274 I10M probably damaging Het
Atp4b G T 8: 13,390,014 H111N probably benign Het
Bbs7 G T 3: 36,613,263 A8E probably benign Het
Bsn C T 9: 108,111,807 V2249M possibly damaging Het
Cpt1a T C 19: 3,381,634 S685P probably damaging Het
Dhx57 A T 17: 80,275,527 H163Q probably benign Het
Duox2 A C 2: 122,287,172 C894G probably benign Het
Ecm1 T C 3: 95,736,588 T209A possibly damaging Het
Glo1 T C 17: 30,600,111 N79S probably benign Het
Gm13078 T A 4: 143,727,108 I262N possibly damaging Het
Gm4763 A T 7: 24,723,622 D90E probably benign Het
Htra1 T A 7: 130,982,279 M388K possibly damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Jag2 C T 12: 112,915,314 E496K probably damaging Het
Kcnh2 C T 5: 24,322,672 R894H probably damaging Het
Khdc1c A G 1: 21,369,609 N128S probably benign Het
Lamc1 T C 1: 153,243,386 N829S probably benign Het
Leprotl1 T C 8: 34,139,035 Y33C probably damaging Het
Map3k3 T A 11: 106,123,792 S130T probably benign Het
Mip C T 10: 128,225,985 A35V probably benign Het
Myh15 A G 16: 49,132,149 R861G probably damaging Het
Myom1 A C 17: 71,077,767 I718L possibly damaging Het
Olfr677 G A 7: 105,056,972 C242Y probably damaging Het
Pde6b A G 5: 108,430,668 E824G probably benign Het
Rbm19 T G 5: 120,130,734 S476A possibly damaging Het
Rpl39l T A 16: 10,174,298 probably null Het
Sec24b A G 3: 130,040,905 S79P probably benign Het
Slc15a2 G A 16: 36,774,573 A146V probably damaging Het
Slmap T C 14: 26,468,520 Y161C probably damaging Het
Smc4 T A 3: 69,025,926 C652S probably damaging Het
Stab1 A G 14: 31,147,274 I1499T probably damaging Het
Tnnt1 A G 7: 4,507,595 L209P probably damaging Het
Trim52 T G 14: 106,107,539 S210R probably benign Het
Tsc22d1 T A 14: 76,418,599 N82K possibly damaging Het
Wdr75 T C 1: 45,817,310 Y498H probably benign Het
Zfp955a C T 17: 33,243,752 S56N probably benign Het
Other mutations in Naip6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00677:Naip6 APN 13 100316017 missense probably benign 0.03
IGL01123:Naip6 APN 13 100304438 missense probably benign 0.02
IGL01151:Naip6 APN 13 100299093 missense probably benign 0.00
IGL01382:Naip6 APN 13 100299856 missense possibly damaging 0.95
IGL01415:Naip6 APN 13 100303290 missense probably benign 0.17
IGL01654:Naip6 APN 13 100299345 missense probably benign 0.00
IGL01662:Naip6 APN 13 100300354 missense probably damaging 1.00
IGL01726:Naip6 APN 13 100303252 missense probably benign 0.02
IGL01810:Naip6 APN 13 100288095 splice site probably benign
IGL01867:Naip6 APN 13 100300312 missense probably benign 0.40
IGL01926:Naip6 APN 13 100300196 missense probably damaging 1.00
IGL01964:Naip6 APN 13 100298730 splice site probably benign
IGL02145:Naip6 APN 13 100296978 missense possibly damaging 0.77
IGL02160:Naip6 APN 13 100299425 missense probably benign 0.01
IGL02214:Naip6 APN 13 100316059 missense probably damaging 1.00
IGL02342:Naip6 APN 13 100303240 missense possibly damaging 0.69
IGL02568:Naip6 APN 13 100316272 missense probably damaging 1.00
IGL02573:Naip6 APN 13 100299471 nonsense probably null
IGL02680:Naip6 APN 13 100283748 missense probably benign
IGL02829:Naip6 APN 13 100300765 missense probably benign 0.11
IGL02833:Naip6 APN 13 100299613 missense probably damaging 1.00
IGL02851:Naip6 APN 13 100300660 missense probably benign 0.01
IGL02860:Naip6 APN 13 100300476 missense possibly damaging 0.95
IGL02886:Naip6 APN 13 100300476 missense possibly damaging 0.95
IGL03155:Naip6 APN 13 100316424 missense possibly damaging 0.62
R0032:Naip6 UTSW 13 100303237 missense probably benign 0.00
R0310:Naip6 UTSW 13 100308213 missense possibly damaging 0.72
R0437:Naip6 UTSW 13 100296924 missense possibly damaging 0.75
R0472:Naip6 UTSW 13 100302260 missense probably benign 0.02
R0560:Naip6 UTSW 13 100300600 missense probably benign 0.08
R0638:Naip6 UTSW 13 100300528 missense probably benign 0.00
R0792:Naip6 UTSW 13 100283766 missense possibly damaging 0.78
R1102:Naip6 UTSW 13 100304415 missense possibly damaging 0.62
R1278:Naip6 UTSW 13 100300362 missense probably damaging 1.00
R1462:Naip6 UTSW 13 100300240 missense possibly damaging 0.64
R1462:Naip6 UTSW 13 100300240 missense possibly damaging 0.64
R1544:Naip6 UTSW 13 100316475 missense probably benign
R1595:Naip6 UTSW 13 100299094 missense probably damaging 0.96
R1749:Naip6 UTSW 13 100308255 missense probably benign 0.03
R1838:Naip6 UTSW 13 100316136 missense probably damaging 0.99
R1863:Naip6 UTSW 13 100300559 missense probably benign 0.03
R1914:Naip6 UTSW 13 100299428 missense probably benign 0.13
R2001:Naip6 UTSW 13 100300729 missense probably benign 0.44
R2082:Naip6 UTSW 13 100304344 splice site probably null
R2143:Naip6 UTSW 13 100299859 missense probably damaging 1.00
R2174:Naip6 UTSW 13 100298987 missense probably benign
R2266:Naip6 UTSW 13 100283559 missense possibly damaging 0.46
R2284:Naip6 UTSW 13 100300600 missense probably benign 0.08
R2285:Naip6 UTSW 13 100300600 missense probably benign 0.08
R2286:Naip6 UTSW 13 100300600 missense probably benign 0.08
R2351:Naip6 UTSW 13 100283661 missense probably damaging 1.00
R2363:Naip6 UTSW 13 100316420 missense possibly damaging 0.90
R2445:Naip6 UTSW 13 100300668 missense probably damaging 0.99
R2971:Naip6 UTSW 13 100300600 missense probably benign 0.08
R2975:Naip6 UTSW 13 100288187 missense probably damaging 1.00
R3081:Naip6 UTSW 13 100300453 missense probably benign
R3082:Naip6 UTSW 13 100316417 missense probably benign 0.00
R3122:Naip6 UTSW 13 100316523 missense probably benign 0.00
R3417:Naip6 UTSW 13 100300600 missense probably benign 0.08
R3943:Naip6 UTSW 13 100294739 missense probably benign 0.01
R3944:Naip6 UTSW 13 100294739 missense probably benign 0.01
R4080:Naip6 UTSW 13 100299307 missense probably damaging 1.00
R4166:Naip6 UTSW 13 100316149 missense probably benign 0.23
R4396:Naip6 UTSW 13 100300600 missense probably benign 0.08
R4397:Naip6 UTSW 13 100300600 missense probably benign 0.08
R4418:Naip6 UTSW 13 100300600 missense probably benign 0.08
R4512:Naip6 UTSW 13 100300600 missense probably benign 0.08
R4670:Naip6 UTSW 13 100294731 critical splice donor site probably null
R4671:Naip6 UTSW 13 100294731 critical splice donor site probably null
R4722:Naip6 UTSW 13 100307072 missense possibly damaging 0.72
R4811:Naip6 UTSW 13 100285791 missense probably damaging 1.00
R4900:Naip6 UTSW 13 100296969 missense probably damaging 0.99
R5162:Naip6 UTSW 13 100300600 missense probably benign 0.08
R5316:Naip6 UTSW 13 100283782 missense probably benign 0.00
R5403:Naip6 UTSW 13 100300077 missense probably benign 0.12
R5437:Naip6 UTSW 13 100303304 nonsense probably null
R5507:Naip6 UTSW 13 100298915 missense probably benign 0.01
R5631:Naip6 UTSW 13 100300138 missense probably benign 0.02
R5657:Naip6 UTSW 13 100300401 missense probably benign
R5684:Naip6 UTSW 13 100300380 missense probably damaging 1.00
R5786:Naip6 UTSW 13 100300216 missense probably benign
R5787:Naip6 UTSW 13 100300216 missense probably benign
R5788:Naip6 UTSW 13 100300216 missense probably benign
R5878:Naip6 UTSW 13 100299673 missense probably damaging 1.00
R5895:Naip6 UTSW 13 100315992 missense possibly damaging 0.90
R5898:Naip6 UTSW 13 100299321 missense possibly damaging 0.93
R6113:Naip6 UTSW 13 100299286 missense possibly damaging 0.96
R6141:Naip6 UTSW 13 100308233 missense possibly damaging 0.91
R6199:Naip6 UTSW 13 100300600 missense probably benign 0.08
R6321:Naip6 UTSW 13 100300401 missense probably benign
R6402:Naip6 UTSW 13 100300718 missense probably benign 0.30
R6435:Naip6 UTSW 13 100294741 missense probably benign 0.04
R6477:Naip6 UTSW 13 100316008 missense probably damaging 1.00
R6601:Naip6 UTSW 13 100283758 missense probably benign
R6638:Naip6 UTSW 13 100300401 missense probably benign
R6639:Naip6 UTSW 13 100300401 missense probably benign
R6804:Naip6 UTSW 13 100299167 missense probably benign
R6922:Naip6 UTSW 13 100302198 missense possibly damaging 0.88
R6975:Naip6 UTSW 13 100316265 missense probably damaging 1.00
R7050:Naip6 UTSW 13 100315499 missense probably damaging 1.00
R7135:Naip6 UTSW 13 100300419 missense probably damaging 1.00
R7140:Naip6 UTSW 13 100300200 missense possibly damaging 0.95
R7182:Naip6 UTSW 13 100316149 missense probably benign 0.23
R7196:Naip6 UTSW 13 100300158 missense probably benign 0.10
R7234:Naip6 UTSW 13 100315503 nonsense probably null
R7259:Naip6 UTSW 13 100304355 missense probably damaging 1.00
R7322:Naip6 UTSW 13 100299388 missense possibly damaging 0.94
R7332:Naip6 UTSW 13 100300701 missense possibly damaging 0.62
R7339:Naip6 UTSW 13 100316019 missense probably damaging 1.00
R7353:Naip6 UTSW 13 100299751 missense probably benign 0.00
R7485:Naip6 UTSW 13 100283851 missense probably benign 0.07
R7597:Naip6 UTSW 13 100300600 missense probably benign 0.08
R7835:Naip6 UTSW 13 100316004 missense probably benign 0.19
R7840:Naip6 UTSW 13 100315471 missense probably damaging 1.00
R7918:Naip6 UTSW 13 100316004 missense probably benign 0.19
R7923:Naip6 UTSW 13 100315471 missense probably damaging 1.00
X0066:Naip6 UTSW 13 100315462 nonsense probably null
Z1177:Naip6 UTSW 13 100299417 missense probably benign 0.20
Z1177:Naip6 UTSW 13 100300800 missense probably damaging 1.00
Z1177:Naip6 UTSW 13 100316130 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gagaaataaaccccaccccc -3'
Posted On2013-11-07