Incidental Mutation 'R0940:Nomo1'
ID81406
Institutional Source Beutler Lab
Gene Symbol Nomo1
Ensembl Gene ENSMUSG00000030835
Gene Namenodal modulator 1
SynonymsPM5, D7Ertd156e, Nomo
MMRRC Submission 039079-MU
Accession Numbers

NCBI RefSeq: NM_153057.4; MGI: 2385850

Is this an essential gene? Possibly essential (E-score: 0.516) question?
Stock #R0940 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location46033698-46084212 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46033905 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 25 (E25G)
Ref Sequence ENSEMBL: ENSMUSP00000033121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002850] [ENSMUST00000033121]
Predicted Effect probably benign
Transcript: ENSMUST00000002850
SMART Domains Protein: ENSMUSP00000002850
Gene: ENSMUSG00000030834

DomainStartEndE-ValueType
transmembrane domain 44 61 N/A INTRINSIC
transmembrane domain 81 100 N/A INTRINSIC
transmembrane domain 110 129 N/A INTRINSIC
transmembrane domain 142 161 N/A INTRINSIC
transmembrane domain 171 193 N/A INTRINSIC
Pfam:ABC_membrane 309 580 3.5e-29 PFAM
AAA 653 828 1.19e-9 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:ABC_membrane 942 1211 2.5e-32 PFAM
AAA 1286 1473 1.71e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000033121
AA Change: E25G

PolyPhen 2 Score 0.565 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000033121
Gene: ENSMUSG00000030835
AA Change: E25G

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
internal_repeat_1 22 215 2.35e-7 PROSPERO
Pfam:CarboxypepD_reg 322 395 3.5e-12 PFAM
Pfam:DUF2012 331 401 5.7e-10 PFAM
low complexity region 709 732 N/A INTRINSIC
low complexity region 881 893 N/A INTRINSIC
Blast:FN3 913 1017 6e-22 BLAST
low complexity region 1156 1164 N/A INTRINSIC
low complexity region 1203 1214 N/A INTRINSIC
Meta Mutation Damage Score 0.0768 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.1%
  • 10x: 98.0%
  • 20x: 96.7%
Validation Efficiency 100% (68/68)
Allele List at MGI

All alleles(8) : Gene trapped(8)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810064F22Rik C T 9: 22,208,071 noncoding transcript Het
2610021A01Rik T G 7: 41,626,434 I520M probably damaging Het
Ackr4 A G 9: 104,099,632 F39L probably damaging Het
Adgre5 C T 8: 83,733,497 S92N probably damaging Het
Adrb2 T C 18: 62,179,691 D21G probably benign Het
AI464131 A G 4: 41,497,996 Y545H probably damaging Het
Akr1c6 G A 13: 4,436,373 E60K probably benign Het
Bcl7c T A 7: 127,707,331 N96I possibly damaging Het
Brca1 A T 11: 101,532,143 S106R possibly damaging Het
C6 A T 15: 4,735,235 T138S probably benign Het
Cul3 T C 1: 80,322,847 probably benign Het
Dnah8 T A 17: 30,803,243 M3939K probably damaging Het
Dock4 T A 12: 40,631,627 probably benign Het
Dsc2 T G 18: 20,050,059 T101P probably damaging Het
Dynlt1b T C 17: 6,430,250 probably benign Het
E330013P04Rik A G 19: 60,161,922 noncoding transcript Het
Fam160a1 A G 3: 85,665,490 V952A possibly damaging Het
Fggy A G 4: 95,697,001 E39G probably benign Het
Fmo6 A T 1: 162,926,226 C116S probably benign Het
Gadd45a A G 6: 67,036,829 I44T possibly damaging Het
Gmps A G 3: 63,976,322 probably benign Het
Gnmt A G 17: 46,726,345 L171P probably damaging Het
Hnrnpm G A 17: 33,650,002 R523C probably damaging Het
Inpp5a T C 7: 139,525,738 Y202H probably damaging Het
Kank3 C T 17: 33,817,476 S106F probably damaging Het
Lmcd1 A G 6: 112,328,697 D253G probably benign Het
Lrrk2 A T 15: 91,729,081 I803F possibly damaging Het
Mybpc2 T C 7: 44,506,887 K834R probably benign Het
Mycbp2 A T 14: 103,262,693 probably benign Het
Myh4 A T 11: 67,242,863 N243Y probably damaging Het
Nfatc1 C T 18: 80,635,895 M759I probably benign Het
Nipal4 A G 11: 46,150,312 I352T possibly damaging Het
Olfr1221 T A 2: 89,112,075 I146L probably benign Het
Olfr128 A G 17: 37,923,700 I45V probably damaging Het
Olfr1408 A G 1: 173,130,453 S255P probably benign Het
Olfr392 T C 11: 73,814,224 N286S probably damaging Het
Olfr490 T C 7: 108,287,057 D23G probably benign Het
Olfr525 T C 7: 140,323,152 I151T probably benign Het
Pabpn1l A G 8: 122,622,444 V78A probably benign Het
Pde6b T A 5: 108,420,337 I327N possibly damaging Het
Phrf1 T C 7: 141,254,855 probably benign Het
Pkm C T 9: 59,668,535 probably benign Het
Plxna2 G A 1: 194,800,555 V1519I probably benign Het
Ppp2cb T C 8: 33,615,661 probably null Het
Prickle2 A G 6: 92,411,003 Y473H probably benign Het
Prpf3 A G 3: 95,844,223 W389R probably damaging Het
Psme4 G A 11: 30,815,264 E544K possibly damaging Het
Relb A T 7: 19,611,842 D395E probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf213 A G 11: 119,416,563 N683S probably benign Het
Rtel1 T C 2: 181,322,803 C102R probably benign Het
Sel1l3 C T 5: 53,144,037 probably benign Het
Slc8a2 A G 7: 16,144,962 T458A probably benign Het
Smc3 T A 19: 53,640,909 M931K probably benign Het
Sorbs2 T C 8: 45,796,502 V795A probably benign Het
Tgm3 A G 2: 130,012,406 S2G probably benign Het
Tpbpa T C 13: 60,940,053 T75A probably damaging Het
Trub1 A G 19: 57,485,063 probably benign Het
Uggt2 A G 14: 119,091,192 probably null Het
Ugt2a3 A G 5: 87,327,206 V393A possibly damaging Het
Vav3 T A 3: 109,562,835 M532K possibly damaging Het
Zfp616 A T 11: 74,085,024 K706N probably damaging Het
Zkscan1 T C 5: 138,093,170 F55S probably damaging Het
Other mutations in Nomo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Nomo1 APN 7 46045336 missense possibly damaging 0.66
IGL00811:Nomo1 APN 7 46083308 missense possibly damaging 0.95
IGL01710:Nomo1 APN 7 46038556 missense probably damaging 1.00
IGL01797:Nomo1 APN 7 46056662 missense probably damaging 0.96
IGL01973:Nomo1 APN 7 46083227 splice site probably benign
IGL02506:Nomo1 APN 7 46078056 missense possibly damaging 0.50
IGL02739:Nomo1 APN 7 46044307 splice site probably null
IGL02863:Nomo1 APN 7 46046916 missense probably damaging 0.98
P0005:Nomo1 UTSW 7 46037557 critical splice acceptor site probably null
PIT4243001:Nomo1 UTSW 7 46044281 missense probably damaging 1.00
R0106:Nomo1 UTSW 7 46037632 missense probably damaging 1.00
R0106:Nomo1 UTSW 7 46037632 missense probably damaging 1.00
R0124:Nomo1 UTSW 7 46083228 splice site probably benign
R0239:Nomo1 UTSW 7 46079594 critical splice donor site probably null
R0239:Nomo1 UTSW 7 46079594 critical splice donor site probably null
R0417:Nomo1 UTSW 7 46068698 missense possibly damaging 0.51
R0467:Nomo1 UTSW 7 46072487 splice site probably null
R0535:Nomo1 UTSW 7 46072517 missense probably damaging 0.99
R0829:Nomo1 UTSW 7 46076172 splice site probably benign
R1480:Nomo1 UTSW 7 46060913 missense probably damaging 0.98
R1601:Nomo1 UTSW 7 46046955 missense probably damaging 0.96
R1743:Nomo1 UTSW 7 46070037 critical splice donor site probably null
R1765:Nomo1 UTSW 7 46066293 missense possibly damaging 0.59
R1861:Nomo1 UTSW 7 46078101 missense probably benign 0.06
R1998:Nomo1 UTSW 7 46033944 missense possibly damaging 0.69
R1999:Nomo1 UTSW 7 46056727 missense possibly damaging 0.95
R2145:Nomo1 UTSW 7 46066504 missense probably damaging 1.00
R2869:Nomo1 UTSW 7 46046937 missense probably damaging 0.96
R2869:Nomo1 UTSW 7 46046937 missense probably damaging 0.96
R2870:Nomo1 UTSW 7 46046937 missense probably damaging 0.96
R2870:Nomo1 UTSW 7 46046937 missense probably damaging 0.96
R2871:Nomo1 UTSW 7 46046937 missense probably damaging 0.96
R2871:Nomo1 UTSW 7 46046937 missense probably damaging 0.96
R2873:Nomo1 UTSW 7 46046937 missense probably damaging 0.96
R4116:Nomo1 UTSW 7 46033896 missense probably benign 0.06
R4404:Nomo1 UTSW 7 46056668 missense probably benign 0.00
R4406:Nomo1 UTSW 7 46056668 missense probably benign 0.00
R4560:Nomo1 UTSW 7 46041480 missense probably damaging 0.99
R4633:Nomo1 UTSW 7 46050260 splice site probably benign
R4651:Nomo1 UTSW 7 46068442 missense probably damaging 0.99
R4653:Nomo1 UTSW 7 46061813 missense probably benign 0.01
R4752:Nomo1 UTSW 7 46057202 missense probably damaging 1.00
R4792:Nomo1 UTSW 7 46044219 splice site probably null
R4838:Nomo1 UTSW 7 46083715 missense unknown
R4876:Nomo1 UTSW 7 46066491 missense probably damaging 1.00
R4915:Nomo1 UTSW 7 46044232 missense probably benign 0.30
R4953:Nomo1 UTSW 7 46050731 intron probably benign
R5463:Nomo1 UTSW 7 46063002 missense possibly damaging 0.47
R5664:Nomo1 UTSW 7 46076157 missense probably benign
R5956:Nomo1 UTSW 7 46042613 missense possibly damaging 0.51
R6037:Nomo1 UTSW 7 46062999 missense possibly damaging 0.64
R6037:Nomo1 UTSW 7 46062999 missense possibly damaging 0.64
R6307:Nomo1 UTSW 7 46033836 unclassified probably benign
R6695:Nomo1 UTSW 7 46066461 missense probably benign 0.16
R6970:Nomo1 UTSW 7 46045967 missense probably damaging 0.97
R7334:Nomo1 UTSW 7 46083268 missense probably damaging 1.00
R7394:Nomo1 UTSW 7 46066479 missense probably benign 0.26
R7556:Nomo1 UTSW 7 46066218 missense probably damaging 1.00
R7834:Nomo1 UTSW 7 46056738 critical splice donor site probably null
R8193:Nomo1 UTSW 7 46042613 missense possibly damaging 0.51
Z1177:Nomo1 UTSW 7 46066273 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- CGTGACGATGACTCTGAAGTGGAAG -3'
(R):5'- CCAAGTTCTGCAATATGGGTTGGGC -3'

Sequencing Primer
(F):5'- ACTCTGAAGTGGAAGCCTGTC -3'
(R):5'- CAGATTAGAGTTTCGGAGGTCC -3'
Posted On2013-11-07