Incidental Mutation 'R0940:Inpp5a'
ID81412
Institutional Source Beutler Lab
Gene Symbol Inpp5a
Ensembl Gene ENSMUSG00000025477
Gene Nameinositol polyphosphate-5-phosphatase A
Synonyms
MMRRC Submission 039079-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0940 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location139389109-139579652 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 139525738 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 202 (Y202H)
Ref Sequence ENSEMBL: ENSMUSP00000101704 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026550] [ENSMUST00000097975] [ENSMUST00000106098]
Predicted Effect probably damaging
Transcript: ENSMUST00000026550
AA Change: Y202H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000026550
Gene: ENSMUSG00000025477
AA Change: Y202H

DomainStartEndE-ValueType
IPPc 8 400 2.48e-165 SMART
low complexity region 415 422 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097975
AA Change: Y210H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000095589
Gene: ENSMUSG00000025477
AA Change: Y210H

DomainStartEndE-ValueType
IPPc 25 408 1.84e-150 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106098
AA Change: Y202H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101704
Gene: ENSMUSG00000025477
AA Change: Y202H

DomainStartEndE-ValueType
IPPc 8 400 2.48e-165 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152475
Meta Mutation Damage Score 0.8655 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.1%
  • 10x: 98.0%
  • 20x: 96.7%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane-associated type I inositol 1,4,5-trisphosphate (InsP3) 5-phosphatase. InsP3 5-phosphatases hydrolyze Ins(1,4,5)P3, which mobilizes intracellular calcium and acts as a second messenger mediating cell responses to various stimulation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most mice homozygous for a gene trapped allele show preweaning lethality, while surviving mice exhibit decreased body size, small cerebellum, and early-onset, slowly progressive Purkinje cell degeneration, gliosis, and ataxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810064F22Rik C T 9: 22,208,071 noncoding transcript Het
2610021A01Rik T G 7: 41,626,434 I520M probably damaging Het
Ackr4 A G 9: 104,099,632 F39L probably damaging Het
Adgre5 C T 8: 83,733,497 S92N probably damaging Het
Adrb2 T C 18: 62,179,691 D21G probably benign Het
AI464131 A G 4: 41,497,996 Y545H probably damaging Het
Akr1c6 G A 13: 4,436,373 E60K probably benign Het
Bcl7c T A 7: 127,707,331 N96I possibly damaging Het
Brca1 A T 11: 101,532,143 S106R possibly damaging Het
C6 A T 15: 4,735,235 T138S probably benign Het
Cul3 T C 1: 80,322,847 probably benign Het
Dnah8 T A 17: 30,803,243 M3939K probably damaging Het
Dock4 T A 12: 40,631,627 probably benign Het
Dsc2 T G 18: 20,050,059 T101P probably damaging Het
Dynlt1b T C 17: 6,430,250 probably benign Het
E330013P04Rik A G 19: 60,161,922 noncoding transcript Het
Fam160a1 A G 3: 85,665,490 V952A possibly damaging Het
Fggy A G 4: 95,697,001 E39G probably benign Het
Fmo6 A T 1: 162,926,226 C116S probably benign Het
Gadd45a A G 6: 67,036,829 I44T possibly damaging Het
Gmps A G 3: 63,976,322 probably benign Het
Gnmt A G 17: 46,726,345 L171P probably damaging Het
Hnrnpm G A 17: 33,650,002 R523C probably damaging Het
Kank3 C T 17: 33,817,476 S106F probably damaging Het
Lmcd1 A G 6: 112,328,697 D253G probably benign Het
Lrrk2 A T 15: 91,729,081 I803F possibly damaging Het
Mybpc2 T C 7: 44,506,887 K834R probably benign Het
Mycbp2 A T 14: 103,262,693 probably benign Het
Myh4 A T 11: 67,242,863 N243Y probably damaging Het
Nfatc1 C T 18: 80,635,895 M759I probably benign Het
Nipal4 A G 11: 46,150,312 I352T possibly damaging Het
Nomo1 A G 7: 46,033,905 E25G possibly damaging Het
Olfr1221 T A 2: 89,112,075 I146L probably benign Het
Olfr128 A G 17: 37,923,700 I45V probably damaging Het
Olfr1408 A G 1: 173,130,453 S255P probably benign Het
Olfr392 T C 11: 73,814,224 N286S probably damaging Het
Olfr490 T C 7: 108,287,057 D23G probably benign Het
Olfr525 T C 7: 140,323,152 I151T probably benign Het
Pabpn1l A G 8: 122,622,444 V78A probably benign Het
Pde6b T A 5: 108,420,337 I327N possibly damaging Het
Phrf1 T C 7: 141,254,855 probably benign Het
Pkm C T 9: 59,668,535 probably benign Het
Plxna2 G A 1: 194,800,555 V1519I probably benign Het
Ppp2cb T C 8: 33,615,661 probably null Het
Prickle2 A G 6: 92,411,003 Y473H probably benign Het
Prpf3 A G 3: 95,844,223 W389R probably damaging Het
Psme4 G A 11: 30,815,264 E544K possibly damaging Het
Relb A T 7: 19,611,842 D395E probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf213 A G 11: 119,416,563 N683S probably benign Het
Rtel1 T C 2: 181,322,803 C102R probably benign Het
Sel1l3 C T 5: 53,144,037 probably benign Het
Slc8a2 A G 7: 16,144,962 T458A probably benign Het
Smc3 T A 19: 53,640,909 M931K probably benign Het
Sorbs2 T C 8: 45,796,502 V795A probably benign Het
Tgm3 A G 2: 130,012,406 S2G probably benign Het
Tpbpa T C 13: 60,940,053 T75A probably damaging Het
Trub1 A G 19: 57,485,063 probably benign Het
Uggt2 A G 14: 119,091,192 probably null Het
Ugt2a3 A G 5: 87,327,206 V393A possibly damaging Het
Vav3 T A 3: 109,562,835 M532K possibly damaging Het
Zfp616 A T 11: 74,085,024 K706N probably damaging Het
Zkscan1 T C 5: 138,093,170 F55S probably damaging Het
Other mutations in Inpp5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Inpp5a APN 7 139516721 missense probably benign 0.00
IGL01354:Inpp5a APN 7 139538234 missense probably damaging 0.99
IGL01734:Inpp5a APN 7 139454090 missense possibly damaging 0.92
IGL02536:Inpp5a APN 7 139567422 missense probably benign 0.17
IGL03023:Inpp5a APN 7 139525786 splice site probably null
IGL03390:Inpp5a APN 7 139525748 missense probably benign 0.01
Anza UTSW 7 139525738 missense probably damaging 1.00
borrego UTSW 7 139525670 missense probably damaging 1.00
Joshua_tree UTSW 7 139574982 missense probably damaging 1.00
PIT4402001:Inpp5a UTSW 7 139511453 missense probably benign 0.02
R0724:Inpp5a UTSW 7 139516663 missense probably benign 0.08
R1258:Inpp5a UTSW 7 139525744 missense probably damaging 1.00
R2112:Inpp5a UTSW 7 139574961 missense probably damaging 0.99
R2328:Inpp5a UTSW 7 139478094 nonsense probably null
R4223:Inpp5a UTSW 7 139558905 missense possibly damaging 0.72
R4307:Inpp5a UTSW 7 139574963 missense possibly damaging 0.87
R4703:Inpp5a UTSW 7 139558923 missense probably damaging 1.00
R4781:Inpp5a UTSW 7 139478005 missense probably benign 0.11
R4997:Inpp5a UTSW 7 139400738 missense probably benign 0.07
R5762:Inpp5a UTSW 7 139538181 missense possibly damaging 0.95
R6014:Inpp5a UTSW 7 139574982 missense probably damaging 1.00
R6381:Inpp5a UTSW 7 139400673 missense probably benign 0.00
R7255:Inpp5a UTSW 7 139511448 missense probably damaging 0.96
R7324:Inpp5a UTSW 7 139525670 missense probably damaging 1.00
R7362:Inpp5a UTSW 7 139578380 missense probably benign 0.00
R7561:Inpp5a UTSW 7 139567422 missense probably damaging 0.99
R7748:Inpp5a UTSW 7 139574995 missense probably damaging 0.96
R8178:Inpp5a UTSW 7 139538237 missense probably damaging 1.00
R8253:Inpp5a UTSW 7 139481640 missense probably damaging 0.99
Z1177:Inpp5a UTSW 7 139525775 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGAGGCAATGCTGTAGTTCACTCTG -3'
(R):5'- TGCCATCTGTCAATGTGCAGCTC -3'

Sequencing Primer
(F):5'- GTGCTCAGGACTTTGATGCTAAAC -3'
(R):5'- GCATGAGACCTTCAGGTATAGCTC -3'
Posted On2013-11-07