Incidental Mutation 'R0940:Adgre5'
ID81421
Institutional Source Beutler Lab
Gene Symbol Adgre5
Ensembl Gene ENSMUSG00000002885
Gene Nameadhesion G protein-coupled receptor E5
SynonymsCd97, EGF-TM7 receptor
MMRRC Submission 039079-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0940 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location83723251-83741326 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 83733497 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 92 (S92N)
Ref Sequence ENSEMBL: ENSMUSP00000075240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002964] [ENSMUST00000075843] [ENSMUST00000109802] [ENSMUST00000149368] [ENSMUST00000166939]
Predicted Effect probably damaging
Transcript: ENSMUST00000002964
AA Change: S92N

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000002964
Gene: ENSMUSG00000002885
AA Change: S92N

DomainStartEndE-ValueType
EGF 30 68 1.63e1 SMART
EGF_CA 69 119 5.92e-8 SMART
EGF_CA 120 167 1.78e-11 SMART
GPS 384 430 2.18e-8 SMART
Pfam:Dicty_CAR 431 703 1.3e-8 PFAM
Pfam:7tm_2 432 672 8.1e-68 PFAM
low complexity region 704 714 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000075843
AA Change: S92N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075240
Gene: ENSMUSG00000002885
AA Change: S92N

DomainStartEndE-ValueType
EGF 30 68 1.63e1 SMART
EGF_CA 69 119 5.92e-8 SMART
EGF_CA 165 213 1.38e-8 SMART
EGF_CA 214 261 1.78e-11 SMART
GPS 478 524 2.18e-8 SMART
Pfam:Dicty_CAR 525 798 4.6e-8 PFAM
Pfam:7tm_2 526 766 5.3e-68 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109802
AA Change: S92N

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105427
Gene: ENSMUSG00000002885
AA Change: S92N

DomainStartEndE-ValueType
EGF 30 68 1.63e1 SMART
EGF_CA 69 119 5.92e-8 SMART
EGF_CA 120 168 1.38e-8 SMART
EGF_CA 169 216 1.78e-11 SMART
GPS 433 479 2.18e-8 SMART
Pfam:Dicty_CAR 480 752 5.3e-8 PFAM
Pfam:7tm_2 481 721 7.5e-67 PFAM
low complexity region 753 763 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149368
Predicted Effect probably damaging
Transcript: ENSMUST00000166939
AA Change: S90N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000128220
Gene: ENSMUSG00000002885
AA Change: S90N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
EGF 28 66 1.63e1 SMART
EGF_CA 67 117 5.92e-8 SMART
EGF_CA 118 165 1.78e-11 SMART
GPS 382 428 2.18e-8 SMART
Pfam:Dicty_CAR 429 701 2.1e-7 PFAM
Pfam:7tm_2 430 670 1.7e-66 PFAM
low complexity region 702 712 N/A INTRINSIC
Meta Mutation Damage Score 0.7710 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.1%
  • 10x: 98.0%
  • 20x: 96.7%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the EGF-TM7 subfamily of adhesion G protein-coupled receptors, which mediate cell-cell interactions. These proteins are cleaved by self-catalytic proteolysis into a large extracellular subunit and seven-span transmembrane subunit, which associate at the cell surface as a receptor complex. The encoded protein may play a role in cell adhesion as well as leukocyte recruitment, activation and migration, and contains multiple extracellular EGF-like repeats which mediate binding to chondroitin sulfate and the cell surface complement regulatory protein CD55. Expression of this gene may play a role in the progression of several types of cancer. Alternatively spliced transcript variants encoding multiple isoforms with 3 to 5 EGF-like repeats have been observed for this gene. This gene is found in a cluster with other EGF-TM7 genes on the short arm of chromosome 19. [provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype apart from mild granulocytosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810064F22Rik C T 9: 22,208,071 noncoding transcript Het
2610021A01Rik T G 7: 41,626,434 I520M probably damaging Het
Ackr4 A G 9: 104,099,632 F39L probably damaging Het
Adrb2 T C 18: 62,179,691 D21G probably benign Het
AI464131 A G 4: 41,497,996 Y545H probably damaging Het
Akr1c6 G A 13: 4,436,373 E60K probably benign Het
Bcl7c T A 7: 127,707,331 N96I possibly damaging Het
Brca1 A T 11: 101,532,143 S106R possibly damaging Het
C6 A T 15: 4,735,235 T138S probably benign Het
Cul3 T C 1: 80,322,847 probably benign Het
Dnah8 T A 17: 30,803,243 M3939K probably damaging Het
Dock4 T A 12: 40,631,627 probably benign Het
Dsc2 T G 18: 20,050,059 T101P probably damaging Het
Dynlt1b T C 17: 6,430,250 probably benign Het
E330013P04Rik A G 19: 60,161,922 noncoding transcript Het
Fam160a1 A G 3: 85,665,490 V952A possibly damaging Het
Fggy A G 4: 95,697,001 E39G probably benign Het
Fmo6 A T 1: 162,926,226 C116S probably benign Het
Gadd45a A G 6: 67,036,829 I44T possibly damaging Het
Gmps A G 3: 63,976,322 probably benign Het
Gnmt A G 17: 46,726,345 L171P probably damaging Het
Hnrnpm G A 17: 33,650,002 R523C probably damaging Het
Inpp5a T C 7: 139,525,738 Y202H probably damaging Het
Kank3 C T 17: 33,817,476 S106F probably damaging Het
Lmcd1 A G 6: 112,328,697 D253G probably benign Het
Lrrk2 A T 15: 91,729,081 I803F possibly damaging Het
Mybpc2 T C 7: 44,506,887 K834R probably benign Het
Mycbp2 A T 14: 103,262,693 probably benign Het
Myh4 A T 11: 67,242,863 N243Y probably damaging Het
Nfatc1 C T 18: 80,635,895 M759I probably benign Het
Nipal4 A G 11: 46,150,312 I352T possibly damaging Het
Nomo1 A G 7: 46,033,905 E25G possibly damaging Het
Olfr1221 T A 2: 89,112,075 I146L probably benign Het
Olfr128 A G 17: 37,923,700 I45V probably damaging Het
Olfr1408 A G 1: 173,130,453 S255P probably benign Het
Olfr392 T C 11: 73,814,224 N286S probably damaging Het
Olfr490 T C 7: 108,287,057 D23G probably benign Het
Olfr525 T C 7: 140,323,152 I151T probably benign Het
Pabpn1l A G 8: 122,622,444 V78A probably benign Het
Pde6b T A 5: 108,420,337 I327N possibly damaging Het
Phrf1 T C 7: 141,254,855 probably benign Het
Pkm C T 9: 59,668,535 probably benign Het
Plxna2 G A 1: 194,800,555 V1519I probably benign Het
Ppp2cb T C 8: 33,615,661 probably null Het
Prickle2 A G 6: 92,411,003 Y473H probably benign Het
Prpf3 A G 3: 95,844,223 W389R probably damaging Het
Psme4 G A 11: 30,815,264 E544K possibly damaging Het
Relb A T 7: 19,611,842 D395E probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf213 A G 11: 119,416,563 N683S probably benign Het
Rtel1 T C 2: 181,322,803 C102R probably benign Het
Sel1l3 C T 5: 53,144,037 probably benign Het
Slc8a2 A G 7: 16,144,962 T458A probably benign Het
Smc3 T A 19: 53,640,909 M931K probably benign Het
Sorbs2 T C 8: 45,796,502 V795A probably benign Het
Tgm3 A G 2: 130,012,406 S2G probably benign Het
Tpbpa T C 13: 60,940,053 T75A probably damaging Het
Trub1 A G 19: 57,485,063 probably benign Het
Uggt2 A G 14: 119,091,192 probably null Het
Ugt2a3 A G 5: 87,327,206 V393A possibly damaging Het
Vav3 T A 3: 109,562,835 M532K possibly damaging Het
Zfp616 A T 11: 74,085,024 K706N probably damaging Het
Zkscan1 T C 5: 138,093,170 F55S probably damaging Het
Other mutations in Adgre5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Adgre5 APN 8 83728401 missense probably benign 0.01
IGL01365:Adgre5 APN 8 83723889 intron probably null
IGL01661:Adgre5 APN 8 83727935 missense probably damaging 0.99
IGL01707:Adgre5 APN 8 83724347 missense probably damaging 1.00
IGL01760:Adgre5 APN 8 83731957 missense probably benign 0.02
IGL02207:Adgre5 APN 8 83728284 missense probably damaging 1.00
IGL02483:Adgre5 APN 8 83725253 missense probably damaging 1.00
IGL03194:Adgre5 APN 8 83734018 missense possibly damaging 0.67
BB001:Adgre5 UTSW 8 83729400 missense possibly damaging 0.85
BB011:Adgre5 UTSW 8 83729400 missense possibly damaging 0.85
PIT4453001:Adgre5 UTSW 8 83724460 missense probably benign 0.08
R0024:Adgre5 UTSW 8 83728284 missense probably damaging 1.00
R0137:Adgre5 UTSW 8 83724898 missense probably damaging 1.00
R0257:Adgre5 UTSW 8 83731995 missense possibly damaging 0.54
R0485:Adgre5 UTSW 8 83731998 missense probably damaging 0.99
R0522:Adgre5 UTSW 8 83730176 missense probably benign 0.30
R1372:Adgre5 UTSW 8 83728320 missense probably damaging 0.96
R1617:Adgre5 UTSW 8 83730177 missense possibly damaging 0.50
R1679:Adgre5 UTSW 8 83729405 missense probably benign 0.09
R1917:Adgre5 UTSW 8 83729109 missense probably damaging 0.99
R1918:Adgre5 UTSW 8 83729109 missense probably damaging 0.99
R2072:Adgre5 UTSW 8 83727804 missense probably benign 0.24
R2831:Adgre5 UTSW 8 83728394 missense possibly damaging 0.80
R5250:Adgre5 UTSW 8 83733440 missense probably benign
R5512:Adgre5 UTSW 8 83729086 missense probably benign
R6077:Adgre5 UTSW 8 83727966 missense probably benign
R7486:Adgre5 UTSW 8 83723886 missense probably damaging 1.00
R7733:Adgre5 UTSW 8 83729396 missense probably benign 0.06
R7924:Adgre5 UTSW 8 83729400 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- agacagacagaatacagaTGCTGGTGA -3'
(R):5'- GCATGAGCACTGCTGGGGAA -3'

Sequencing Primer
(F):5'- agaatacagaTGCTGGTGACCTTG -3'
(R):5'- CAGCTCCAGGAATAGCTTGTTAG -3'
Posted On2013-11-07